FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629440_at:

>probe:Drosophila_2:1629440_at:459:537; Interrogation_Position=338; Antisense; GGTCATCTGATCTTCGATCTGGACA
>probe:Drosophila_2:1629440_at:293:213; Interrogation_Position=362; Antisense; AAGACGGCATCACATCTGCGCGATG
>probe:Drosophila_2:1629440_at:689:157; Interrogation_Position=403; Antisense; ACACATTGCCTTCCGAGATGGCATC
>probe:Drosophila_2:1629440_at:146:441; Interrogation_Position=419; Antisense; GATGGCATCATTCTGTTCTTCAACC
>probe:Drosophila_2:1629440_at:480:55; Interrogation_Position=452; Antisense; ATGAACTCACATCTCGTGGAGCGAA
>probe:Drosophila_2:1629440_at:563:77; Interrogation_Position=483; Antisense; AGGAGGCCGGTGAATTCTCGCACAC
>probe:Drosophila_2:1629440_at:663:581; Interrogation_Position=515; Antisense; TGGCGCGGCGGCATCTTTACCAATG
>probe:Drosophila_2:1629440_at:159:63; Interrogation_Position=543; Antisense; ATGTGCAATTCGATGCGGTCACCAG
>probe:Drosophila_2:1629440_at:595:35; Interrogation_Position=576; Antisense; ATCTTTGCATTTTCCTCAACACTCA
>probe:Drosophila_2:1629440_at:126:179; Interrogation_Position=600; Antisense; AAAACAACGTTATGGCTCAGCACAC
>probe:Drosophila_2:1629440_at:215:559; Interrogation_Position=673; Antisense; GGACAGCAATTGCAATCCCAACCTG
>probe:Drosophila_2:1629440_at:630:287; Interrogation_Position=732; Antisense; CGGCCGCAGTGGAGCTCTATTGCAA
>probe:Drosophila_2:1629440_at:538:117; Interrogation_Position=744; Antisense; AGCTCTATTGCAACCTCTTCAAGGA
>probe:Drosophila_2:1629440_at:316:201; Interrogation_Position=785; Antisense; AAGCGGGAACGACGCCAACTCCTTG

Paste this into a BLAST search page for me
GGTCATCTGATCTTCGATCTGGACAAAGACGGCATCACATCTGCGCGATGACACATTGCCTTCCGAGATGGCATCGATGGCATCATTCTGTTCTTCAACCATGAACTCACATCTCGTGGAGCGAAAGGAGGCCGGTGAATTCTCGCACACTGGCGCGGCGGCATCTTTACCAATGATGTGCAATTCGATGCGGTCACCAGATCTTTGCATTTTCCTCAACACTCAAAAACAACGTTATGGCTCAGCACACGGACAGCAATTGCAATCCCAACCTGCGGCCGCAGTGGAGCTCTATTGCAAAGCTCTATTGCAACCTCTTCAAGGAAAGCGGGAACGACGCCAACTCCTTG

Full Affymetrix probeset data:

Annotations for 1629440_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720