Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629441_at:

>probe:Drosophila_2:1629441_at:532:683; Interrogation_Position=2227; Antisense; TATGCGCATGGATCTGAGTTCGGGA
>probe:Drosophila_2:1629441_at:494:551; Interrogation_Position=2249; Antisense; GGAGATCACATCAAGACCTGGCGAT
>probe:Drosophila_2:1629441_at:289:71; Interrogation_Position=2286; Antisense; AGGCGTGGAACGTCAACTGGAACAT
>probe:Drosophila_2:1629441_at:575:137; Interrogation_Position=2337; Antisense; ACGAGAATGTGGTCTTCTCCTGCCA
>probe:Drosophila_2:1629441_at:291:353; Interrogation_Position=2383; Antisense; GCACGAGTTCATCGGTGGTTACATT
>probe:Drosophila_2:1629441_at:200:589; Interrogation_Position=2398; Antisense; TGGTTACATTTTCATGTCCATGCGA
>probe:Drosophila_2:1629441_at:384:129; Interrogation_Position=2436; Antisense; ACCAGACCCTGAACGAGGAGCTTTT
>probe:Drosophila_2:1629441_at:716:407; Interrogation_Position=2453; Antisense; GAGCTTTTCCACAAACTTACCGGCG
>probe:Drosophila_2:1629441_at:410:535; Interrogation_Position=2481; Antisense; GGTCCTAGTACCATTTATTGCTCGA
>probe:Drosophila_2:1629441_at:550:67; Interrogation_Position=2511; Antisense; ATGGCAGGCAGTTTCAATTGTTCGA
>probe:Drosophila_2:1629441_at:476:455; Interrogation_Position=2577; Antisense; GATAGACTCACAACTTCAATGCAAT
>probe:Drosophila_2:1629441_at:585:135; Interrogation_Position=2672; Antisense; ACGAAAATCGCTTGCCAATGGCCTT
>probe:Drosophila_2:1629441_at:39:695; Interrogation_Position=2697; Antisense; TTTGCCTGCCCAACACCTAATTAGA
>probe:Drosophila_2:1629441_at:163:677; Interrogation_Position=2718; Antisense; TAGACTTAACCGTGGCCTTAGCAAT

Paste this into a BLAST search page for me
TATGCGCATGGATCTGAGTTCGGGAGGAGATCACATCAAGACCTGGCGATAGGCGTGGAACGTCAACTGGAACATACGAGAATGTGGTCTTCTCCTGCCAGCACGAGTTCATCGGTGGTTACATTTGGTTACATTTTCATGTCCATGCGAACCAGACCCTGAACGAGGAGCTTTTGAGCTTTTCCACAAACTTACCGGCGGGTCCTAGTACCATTTATTGCTCGAATGGCAGGCAGTTTCAATTGTTCGAGATAGACTCACAACTTCAATGCAATACGAAAATCGCTTGCCAATGGCCTTTTTGCCTGCCCAACACCTAATTAGATAGACTTAACCGTGGCCTTAGCAAT

Full Affymetrix probeset data:

Annotations for 1629441_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime