FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629442_at:

>probe:Drosophila_2:1629442_at:545:521; Interrogation_Position=154; Antisense; GGGCTGGTCGTTGCCATTCTCGCAC
>probe:Drosophila_2:1629442_at:467:11; Interrogation_Position=169; Antisense; ATTCTCGCACTAACGATCTGGCAGA
>probe:Drosophila_2:1629442_at:243:41; Interrogation_Position=184; Antisense; ATCTGGCAGACAACGCGTGTATCGC
>probe:Drosophila_2:1629442_at:592:513; Interrogation_Position=200; Antisense; GTGTATCGCATCTGGACAAGGAGCT
>probe:Drosophila_2:1629442_at:448:293; Interrogation_Position=21; Antisense; CGAGACCCTCAAGCCGTTTATAACG
>probe:Drosophila_2:1629442_at:209:375; Interrogation_Position=225; Antisense; GAAGAGCCTGAAGCGAGTCGTCGAT
>probe:Drosophila_2:1629442_at:70:327; Interrogation_Position=237; Antisense; GCGAGTCGTCGATAATCTCCAGCAG
>probe:Drosophila_2:1629442_at:711:655; Interrogation_Position=249; Antisense; TAATCTCCAGCAGCGTTTGGGCATA
>probe:Drosophila_2:1629442_at:628:691; Interrogation_Position=264; Antisense; TTTGGGCATAAACTATCTGGACGAG
>probe:Drosophila_2:1629442_at:267:553; Interrogation_Position=282; Antisense; GGACGAGTTCGACGAGTTCCAAAAG
>probe:Drosophila_2:1629442_at:262:125; Interrogation_Position=32; Antisense; AGCCGTTTATAACGCCAACGAGTGC
>probe:Drosophila_2:1629442_at:165:251; Interrogation_Position=47; Antisense; CAACGAGTGCCAACGATGATGGTTT
>probe:Drosophila_2:1629442_at:32:255; Interrogation_Position=57; Antisense; CAACGATGATGGTTTTCCGGCCAAA
>probe:Drosophila_2:1629442_at:646:539; Interrogation_Position=67; Antisense; GGTTTTCCGGCCAAAGCGACCAGCA

Paste this into a BLAST search page for me
GGGCTGGTCGTTGCCATTCTCGCACATTCTCGCACTAACGATCTGGCAGAATCTGGCAGACAACGCGTGTATCGCGTGTATCGCATCTGGACAAGGAGCTCGAGACCCTCAAGCCGTTTATAACGGAAGAGCCTGAAGCGAGTCGTCGATGCGAGTCGTCGATAATCTCCAGCAGTAATCTCCAGCAGCGTTTGGGCATATTTGGGCATAAACTATCTGGACGAGGGACGAGTTCGACGAGTTCCAAAAGAGCCGTTTATAACGCCAACGAGTGCCAACGAGTGCCAACGATGATGGTTTCAACGATGATGGTTTTCCGGCCAAAGGTTTTCCGGCCAAAGCGACCAGCA

Full Affymetrix probeset data:

Annotations for 1629442_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720