Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629443_at:

>probe:Drosophila_2:1629443_at:209:47; Interrogation_Position=125; Antisense; ATCCGCCGGGAAGTCTGAGTGGCCA
>probe:Drosophila_2:1629443_at:461:607; Interrogation_Position=140; Antisense; TGAGTGGCCAGGATCCGCAGTTCAG
>probe:Drosophila_2:1629443_at:709:77; Interrogation_Position=149; Antisense; AGGATCCGCAGTTCAGCTACGGATA
>probe:Drosophila_2:1629443_at:495:93; Interrogation_Position=158; Antisense; AGTTCAGCTACGGATACGCCGGCAT
>probe:Drosophila_2:1629443_at:270:457; Interrogation_Position=170; Antisense; GATACGCCGGCATCGATTCGCGTGG
>probe:Drosophila_2:1629443_at:130:293; Interrogation_Position=183; Antisense; CGATTCGCGTGGTACCTACGGTGGA
>probe:Drosophila_2:1629443_at:406:411; Interrogation_Position=195; Antisense; TACCTACGGTGGAGCGGGTGGCAAT
>probe:Drosophila_2:1629443_at:538:513; Interrogation_Position=31; Antisense; GTGGCGGTGGATGCCCAGGCCGGAA
>probe:Drosophila_2:1629443_at:156:69; Interrogation_Position=47; Antisense; AGGCCGGAACGGTGCACTGGAACAA
>probe:Drosophila_2:1629443_at:536:561; Interrogation_Position=52; Antisense; GGAACGGTGCACTGGAACAATGGAA
>probe:Drosophila_2:1629443_at:698:385; Interrogation_Position=66; Antisense; GAACAATGGAAATGCGGCCGGCGTT
>probe:Drosophila_2:1629443_at:704:231; Interrogation_Position=76; Antisense; AATGCGGCCGGCGTTGGCGTCTATT
>probe:Drosophila_2:1629443_at:122:467; Interrogation_Position=88; Antisense; GTTGGCGTCTATTCGAGCGCCCAGT
>probe:Drosophila_2:1629443_at:644:9; Interrogation_Position=98; Antisense; ATTCGAGCGCCCAGTCCGGCGGGAT

Paste this into a BLAST search page for me
ATCCGCCGGGAAGTCTGAGTGGCCATGAGTGGCCAGGATCCGCAGTTCAGAGGATCCGCAGTTCAGCTACGGATAAGTTCAGCTACGGATACGCCGGCATGATACGCCGGCATCGATTCGCGTGGCGATTCGCGTGGTACCTACGGTGGATACCTACGGTGGAGCGGGTGGCAATGTGGCGGTGGATGCCCAGGCCGGAAAGGCCGGAACGGTGCACTGGAACAAGGAACGGTGCACTGGAACAATGGAAGAACAATGGAAATGCGGCCGGCGTTAATGCGGCCGGCGTTGGCGTCTATTGTTGGCGTCTATTCGAGCGCCCAGTATTCGAGCGCCCAGTCCGGCGGGAT

Full Affymetrix probeset data:

Annotations for 1629443_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime