FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629444_at:

>probe:Drosophila_2:1629444_at:675:463; Interrogation_Position=163; Antisense; GATTCCGCATCCGAAGAAGCTGGCC
>probe:Drosophila_2:1629444_at:451:687; Interrogation_Position=214; Antisense; TATATCCACGAGGAGCGTCATCAAT
>probe:Drosophila_2:1629444_at:485:271; Interrogation_Position=232; Antisense; CATCAATGGCGGCAGGTCGGCAAAC
>probe:Drosophila_2:1629444_at:320:101; Interrogation_Position=298; Antisense; AGAGGGCAATCCACATCTGACGCGA
>probe:Drosophila_2:1629444_at:272:389; Interrogation_Position=343; Antisense; GAAAACCATAGGGATCCGCCTGGAT
>probe:Drosophila_2:1629444_at:407:491; Interrogation_Position=383; Antisense; GTAAATGTGCCCAATTCCACTTCAT
>probe:Drosophila_2:1629444_at:232:435; Interrogation_Position=425; Antisense; GAGGAGGTGCCTGTACCGCAATTGC
>probe:Drosophila_2:1629444_at:251:193; Interrogation_Position=465; Antisense; AACTGAAGGCTCGAACGTATCGGAA
>probe:Drosophila_2:1629444_at:103:423; Interrogation_Position=491; Antisense; GAGAATTCCGATTGCCTTATTCCAC
>probe:Drosophila_2:1629444_at:693:701; Interrogation_Position=507; Antisense; TTATTCCACCGCCAGTTAGTCGCGT
>probe:Drosophila_2:1629444_at:170:93; Interrogation_Position=536; Antisense; AGTTGGTCGGGTCCTTTGAATGCCA
>probe:Drosophila_2:1629444_at:513:87; Interrogation_Position=560; Antisense; AGTCCCTTCAACCAGCTGGATGAGC
>probe:Drosophila_2:1629444_at:608:363; Interrogation_Position=586; Antisense; GAATTCCATCTCTGACGATGCGGAC
>probe:Drosophila_2:1629444_at:202:393; Interrogation_Position=622; Antisense; GAAAGCGATTTGTTTGCCAGATGAT

Paste this into a BLAST search page for me
GATTCCGCATCCGAAGAAGCTGGCCTATATCCACGAGGAGCGTCATCAATCATCAATGGCGGCAGGTCGGCAAACAGAGGGCAATCCACATCTGACGCGAGAAAACCATAGGGATCCGCCTGGATGTAAATGTGCCCAATTCCACTTCATGAGGAGGTGCCTGTACCGCAATTGCAACTGAAGGCTCGAACGTATCGGAAGAGAATTCCGATTGCCTTATTCCACTTATTCCACCGCCAGTTAGTCGCGTAGTTGGTCGGGTCCTTTGAATGCCAAGTCCCTTCAACCAGCTGGATGAGCGAATTCCATCTCTGACGATGCGGACGAAAGCGATTTGTTTGCCAGATGAT

Full Affymetrix probeset data:

Annotations for 1629444_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720