FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629445_at:

>probe:Drosophila_2:1629445_at:204:255; Interrogation_Position=514; Antisense; CAAAGCATCGAACCACTCGTACGTG
>probe:Drosophila_2:1629445_at:305:489; Interrogation_Position=532; Antisense; GTACGTGGTTAACCATGCCGCCAAT
>probe:Drosophila_2:1629445_at:184:561; Interrogation_Position=559; Antisense; GGAACAGATTCTCATGCACATGGGC
>probe:Drosophila_2:1629445_at:106:269; Interrogation_Position=577; Antisense; CATGGGCCTGGAGAACTATGTGACC
>probe:Drosophila_2:1629445_at:624:213; Interrogation_Position=609; Antisense; AAGAGGCTCACATCGATCTGGTGGA
>probe:Drosophila_2:1629445_at:635:39; Interrogation_Position=624; Antisense; ATCTGGTGGAACTGGCATCCTTGGA
>probe:Drosophila_2:1629445_at:106:631; Interrogation_Position=641; Antisense; TCCTTGGAGCGTGCTGATCTTGTTA
>probe:Drosophila_2:1629445_at:89:163; Interrogation_Position=676; Antisense; AAATACCGATGAGGATTGCAACCGT
>probe:Drosophila_2:1629445_at:450:359; Interrogation_Position=693; Antisense; GCAACCGTATCATGGATGTGCTCCA
>probe:Drosophila_2:1629445_at:94:443; Interrogation_Position=707; Antisense; GATGTGCTCCACACTCTTTAAGTGA
>probe:Drosophila_2:1629445_at:85:645; Interrogation_Position=721; Antisense; TCTTTAAGTGAATCGCTGGCATGTC
>probe:Drosophila_2:1629445_at:436:333; Interrogation_Position=735; Antisense; GCTGGCATGTCCATCTTTTATCATA
>probe:Drosophila_2:1629445_at:349:129; Interrogation_Position=853; Antisense; ACCTGGTGTCTTAAAGCTCGTCGTT
>probe:Drosophila_2:1629445_at:449:231; Interrogation_Position=932; Antisense; AATGTTGCTCCGAAGCTCATTTACA

Paste this into a BLAST search page for me
CAAAGCATCGAACCACTCGTACGTGGTACGTGGTTAACCATGCCGCCAATGGAACAGATTCTCATGCACATGGGCCATGGGCCTGGAGAACTATGTGACCAAGAGGCTCACATCGATCTGGTGGAATCTGGTGGAACTGGCATCCTTGGATCCTTGGAGCGTGCTGATCTTGTTAAAATACCGATGAGGATTGCAACCGTGCAACCGTATCATGGATGTGCTCCAGATGTGCTCCACACTCTTTAAGTGATCTTTAAGTGAATCGCTGGCATGTCGCTGGCATGTCCATCTTTTATCATAACCTGGTGTCTTAAAGCTCGTCGTTAATGTTGCTCCGAAGCTCATTTACA

Full Affymetrix probeset data:

Annotations for 1629445_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720