FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629447_at:

>probe:Drosophila_2:1629447_at:591:111; Interrogation_Position=149; Antisense; AGCACAAGGGTGAGCACGGACACAA
>probe:Drosophila_2:1629447_at:421:125; Interrogation_Position=233; Antisense; ACCACCACGGCGACAAGGGATCGAA
>probe:Drosophila_2:1629447_at:698:611; Interrogation_Position=303; Antisense; TGAACACGGCGCTCACAAGAAGGGC
>probe:Drosophila_2:1629447_at:284:373; Interrogation_Position=321; Antisense; GAAGGGCGGCAAACATCATCACAAA
>probe:Drosophila_2:1629447_at:625:373; Interrogation_Position=420; Antisense; GAAGTTCTACGATGATGAGCACAAG
>probe:Drosophila_2:1629447_at:28:113; Interrogation_Position=437; Antisense; AGCACAAGGGCGGACATCATAAGAA
>probe:Drosophila_2:1629447_at:437:113; Interrogation_Position=473; Antisense; AGCACCATCATCATGCCGAGGAGCA
>probe:Drosophila_2:1629447_at:627:371; Interrogation_Position=540; Antisense; GAAGGGTCACAAGAAGCACCACGGA
>probe:Drosophila_2:1629447_at:407:377; Interrogation_Position=552; Antisense; GAAGCACCACGGACACTACAAGAAG
>probe:Drosophila_2:1629447_at:676:489; Interrogation_Position=578; Antisense; GTCACCACGACGAGGACCACAAGAA
>probe:Drosophila_2:1629447_at:454:161; Interrogation_Position=617; Antisense; ACAAGTACGGCGACAGCTTCGAGGA
>probe:Drosophila_2:1629447_at:312:111; Interrogation_Position=650; Antisense; AGCACGGCGAGAAGGGCTCCAAGAA
>probe:Drosophila_2:1629447_at:61:223; Interrogation_Position=661; Antisense; AAGGGCTCCAAGAAGCACGGCCACA
>probe:Drosophila_2:1629447_at:258:113; Interrogation_Position=674; Antisense; AGCACGGCCACAAGCACTACAAAAA

Paste this into a BLAST search page for me
AGCACAAGGGTGAGCACGGACACAAACCACCACGGCGACAAGGGATCGAATGAACACGGCGCTCACAAGAAGGGCGAAGGGCGGCAAACATCATCACAAAGAAGTTCTACGATGATGAGCACAAGAGCACAAGGGCGGACATCATAAGAAAGCACCATCATCATGCCGAGGAGCAGAAGGGTCACAAGAAGCACCACGGAGAAGCACCACGGACACTACAAGAAGGTCACCACGACGAGGACCACAAGAAACAAGTACGGCGACAGCTTCGAGGAAGCACGGCGAGAAGGGCTCCAAGAAAAGGGCTCCAAGAAGCACGGCCACAAGCACGGCCACAAGCACTACAAAAA

Full Affymetrix probeset data:

Annotations for 1629447_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720