FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629448_at:

>probe:Drosophila_2:1629448_at:566:675; Interrogation_Position=102; Antisense; TAGCGTGGTGGAGCAACTGTACAAC
>probe:Drosophila_2:1629448_at:664:481; Interrogation_Position=15; Antisense; GTATTCCACAGCTCATGGCAAGCGG
>probe:Drosophila_2:1629448_at:474:365; Interrogation_Position=198; Antisense; GAATAGTGCCAACAACATACCCCTG
>probe:Drosophila_2:1629448_at:516:619; Interrogation_Position=225; Antisense; TGCTCCAGCCATTATAAGTCGTCGA
>probe:Drosophila_2:1629448_at:395:637; Interrogation_Position=246; Antisense; TCGAGAATCGGAGGATCGGCGAATC
>probe:Drosophila_2:1629448_at:196:113; Interrogation_Position=302; Antisense; AGCACCGCTATCAATTGCGCCAGTT
>probe:Drosophila_2:1629448_at:94:33; Interrogation_Position=311; Antisense; ATCAATTGCGCCAGTTGCAGGATCA
>probe:Drosophila_2:1629448_at:324:467; Interrogation_Position=392; Antisense; GTTGGAGGAAACTGCAGCAGGCTCT
>probe:Drosophila_2:1629448_at:659:615; Interrogation_Position=416; Antisense; TGCAGGCCCAAATCGATGCCGACAA
>probe:Drosophila_2:1629448_at:252:397; Interrogation_Position=436; Antisense; GACAATGAGAACTACTCGGGCTACG
>probe:Drosophila_2:1629448_at:118:281; Interrogation_Position=450; Antisense; CTCGGGCTACGAGCTAACGAAGTGA
>probe:Drosophila_2:1629448_at:293:575; Interrogation_Position=51; Antisense; GGCGGTCATAGATGCTAAACAGCAT
>probe:Drosophila_2:1629448_at:430:155; Interrogation_Position=69; Antisense; ACAGCATCCCTTGCCAAATTCATAT
>probe:Drosophila_2:1629448_at:291:7; Interrogation_Position=86; Antisense; ATTCATATGGCTTGGATAGCGTGGT

Paste this into a BLAST search page for me
TAGCGTGGTGGAGCAACTGTACAACGTATTCCACAGCTCATGGCAAGCGGGAATAGTGCCAACAACATACCCCTGTGCTCCAGCCATTATAAGTCGTCGATCGAGAATCGGAGGATCGGCGAATCAGCACCGCTATCAATTGCGCCAGTTATCAATTGCGCCAGTTGCAGGATCAGTTGGAGGAAACTGCAGCAGGCTCTTGCAGGCCCAAATCGATGCCGACAAGACAATGAGAACTACTCGGGCTACGCTCGGGCTACGAGCTAACGAAGTGAGGCGGTCATAGATGCTAAACAGCATACAGCATCCCTTGCCAAATTCATATATTCATATGGCTTGGATAGCGTGGT

Full Affymetrix probeset data:

Annotations for 1629448_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720