FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629450_at:

>probe:Drosophila_2:1629450_at:206:393; Interrogation_Position=107; Antisense; GAAAGCTCCTCGGATAGTACCAGCG
>probe:Drosophila_2:1629450_at:21:397; Interrogation_Position=167; Antisense; GACACAACTGAAGCCTCAACGTCTT
>probe:Drosophila_2:1629450_at:506:153; Interrogation_Position=203; Antisense; ACAGTGGCCTCGTCTGCCACGACTA
>probe:Drosophila_2:1629450_at:208:13; Interrogation_Position=25; Antisense; ATTCATATTTGTTCTGCTCTTGGCC
>probe:Drosophila_2:1629450_at:259:155; Interrogation_Position=379; Antisense; ACAGCAGCGCAGAAGACGCCAGCAA
>probe:Drosophila_2:1629450_at:407:213; Interrogation_Position=391; Antisense; AAGACGCCAGCAAAGGCAGCGCAGT
>probe:Drosophila_2:1629450_at:10:227; Interrogation_Position=403; Antisense; AAGGCAGCGCAGTGGATAGACGATT
>probe:Drosophila_2:1629450_at:350:453; Interrogation_Position=417; Antisense; GATAGACGATTGCTACAGTCGAAGA
>probe:Drosophila_2:1629450_at:412:573; Interrogation_Position=445; Antisense; GGCTGCTGCAGCTAGAAACCTGTCG
>probe:Drosophila_2:1629450_at:496:431; Interrogation_Position=469; Antisense; GAGTCAGACAGCTAATACAAGCCAA
>probe:Drosophila_2:1629450_at:480:193; Interrogation_Position=507; Antisense; AACTAAATTGCAGTTGCGTTGCTGT
>probe:Drosophila_2:1629450_at:706:327; Interrogation_Position=522; Antisense; GCGTTGCTGTGGGATATTCCGTTTT
>probe:Drosophila_2:1629450_at:680:323; Interrogation_Position=84; Antisense; GCGAAGCTACGGGAACGAGCACTGA
>probe:Drosophila_2:1629450_at:238:383; Interrogation_Position=96; Antisense; GAACGAGCACTGAAAGCTCCTCGGA

Paste this into a BLAST search page for me
GAAAGCTCCTCGGATAGTACCAGCGGACACAACTGAAGCCTCAACGTCTTACAGTGGCCTCGTCTGCCACGACTAATTCATATTTGTTCTGCTCTTGGCCACAGCAGCGCAGAAGACGCCAGCAAAAGACGCCAGCAAAGGCAGCGCAGTAAGGCAGCGCAGTGGATAGACGATTGATAGACGATTGCTACAGTCGAAGAGGCTGCTGCAGCTAGAAACCTGTCGGAGTCAGACAGCTAATACAAGCCAAAACTAAATTGCAGTTGCGTTGCTGTGCGTTGCTGTGGGATATTCCGTTTTGCGAAGCTACGGGAACGAGCACTGAGAACGAGCACTGAAAGCTCCTCGGA

Full Affymetrix probeset data:

Annotations for 1629450_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720