FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629452_at:

>probe:Drosophila_2:1629452_at:324:575; Interrogation_Position=1013; Antisense; GGCGAAGCCAGCTCCTGATGAGATT
>probe:Drosophila_2:1629452_at:32:129; Interrogation_Position=564; Antisense; ACCTTGAGGCAGAGGCCGAGCGCAA
>probe:Drosophila_2:1629452_at:217:581; Interrogation_Position=726; Antisense; TGGCCGACTTCATTCAGTACATTAG
>probe:Drosophila_2:1629452_at:173:161; Interrogation_Position=756; Antisense; ACAAGGTGGTGGTCCTAGAGGATCT
>probe:Drosophila_2:1629452_at:99:287; Interrogation_Position=779; Antisense; CTGGCCGTGGCCTTCAAATTAAAGA
>probe:Drosophila_2:1629452_at:540:103; Interrogation_Position=801; Antisense; AGACGCAGCAGGTCATTGATCGCAT
>probe:Drosophila_2:1629452_at:620:5; Interrogation_Position=815; Antisense; ATTGATCGCATCCAGAACCTGCAGG
>probe:Drosophila_2:1629452_at:494:97; Interrogation_Position=865; Antisense; AGACGACCGCGGCAAGTTCATCTAT
>probe:Drosophila_2:1629452_at:301:361; Interrogation_Position=876; Antisense; GCAAGTTCATCTATGTTTCCGAGAA
>probe:Drosophila_2:1629452_at:257:715; Interrogation_Position=892; Antisense; TTCCGAGAAGGAGCTATTGGCCGTG
>probe:Drosophila_2:1629452_at:50:581; Interrogation_Position=909; Antisense; TGGCCGTGGCCAAGTTCATAAAACA
>probe:Drosophila_2:1629452_at:646:661; Interrogation_Position=927; Antisense; TAAAACAACGCGGACGCGTCTCCAT
>probe:Drosophila_2:1629452_at:423:357; Interrogation_Position=972; Antisense; GCAACAACCTGATTAACCTGACGCC
>probe:Drosophila_2:1629452_at:156:605; Interrogation_Position=981; Antisense; TGATTAACCTGACGCCCATTTCTGC

Paste this into a BLAST search page for me
GGCGAAGCCAGCTCCTGATGAGATTACCTTGAGGCAGAGGCCGAGCGCAATGGCCGACTTCATTCAGTACATTAGACAAGGTGGTGGTCCTAGAGGATCTCTGGCCGTGGCCTTCAAATTAAAGAAGACGCAGCAGGTCATTGATCGCATATTGATCGCATCCAGAACCTGCAGGAGACGACCGCGGCAAGTTCATCTATGCAAGTTCATCTATGTTTCCGAGAATTCCGAGAAGGAGCTATTGGCCGTGTGGCCGTGGCCAAGTTCATAAAACATAAAACAACGCGGACGCGTCTCCATGCAACAACCTGATTAACCTGACGCCTGATTAACCTGACGCCCATTTCTGC

Full Affymetrix probeset data:

Annotations for 1629452_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720