FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629455_at:

>probe:Drosophila_2:1629455_at:277:509; Interrogation_Position=1460; Antisense; GTGCAAGTGGCCATGTGAATCCCCT
>probe:Drosophila_2:1629455_at:675:365; Interrogation_Position=1476; Antisense; GAATCCCCTTCTGGTGGTATTCAGT
>probe:Drosophila_2:1629455_at:77:219; Interrogation_Position=1504; Antisense; AAGTACTGGCGCACCACATGTTTAA
>probe:Drosophila_2:1629455_at:286:153; Interrogation_Position=1519; Antisense; ACATGTTTAACCCTGGTCATCTGGC
>probe:Drosophila_2:1629455_at:95:647; Interrogation_Position=1535; Antisense; TCATCTGGCTGACACTGATCATCAT
>probe:Drosophila_2:1629455_at:485:17; Interrogation_Position=1558; Antisense; ATTTACTTTGGACTCACGTTGCACC
>probe:Drosophila_2:1629455_at:649:279; Interrogation_Position=1605; Antisense; CTACATCAATAGTGCCGTGGCTGGA
>probe:Drosophila_2:1629455_at:180:69; Interrogation_Position=1637; Antisense; AGGCCATCTCCATTTGCATTAGCAT
>probe:Drosophila_2:1629455_at:202:345; Interrogation_Position=1652; Antisense; GCATTAGCATCCTGGTGGTCTTGAA
>probe:Drosophila_2:1629455_at:195:3; Interrogation_Position=1699; Antisense; ATTGGTTACATGTTGTTGCCGGGTC
>probe:Drosophila_2:1629455_at:215:389; Interrogation_Position=1859; Antisense; GAAACTTTGGCGTTGGCATGGGCAA
>probe:Drosophila_2:1629455_at:485:347; Interrogation_Position=1874; Antisense; GCATGGGCAACCTGGCATCGGGCAT
>probe:Drosophila_2:1629455_at:341:391; Interrogation_Position=1926; Antisense; GAAACTGGAGCACATTGATCCCCTG
>probe:Drosophila_2:1629455_at:211:319; Interrogation_Position=1990; Antisense; GCCGTTGCCATCAGCCTTATGAAGG

Paste this into a BLAST search page for me
GTGCAAGTGGCCATGTGAATCCCCTGAATCCCCTTCTGGTGGTATTCAGTAAGTACTGGCGCACCACATGTTTAAACATGTTTAACCCTGGTCATCTGGCTCATCTGGCTGACACTGATCATCATATTTACTTTGGACTCACGTTGCACCCTACATCAATAGTGCCGTGGCTGGAAGGCCATCTCCATTTGCATTAGCATGCATTAGCATCCTGGTGGTCTTGAAATTGGTTACATGTTGTTGCCGGGTCGAAACTTTGGCGTTGGCATGGGCAAGCATGGGCAACCTGGCATCGGGCATGAAACTGGAGCACATTGATCCCCTGGCCGTTGCCATCAGCCTTATGAAGG

Full Affymetrix probeset data:

Annotations for 1629455_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720