FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629458_at:

>probe:Drosophila_2:1629458_at:473:337; Interrogation_Position=3099; Antisense; GCTCCGATGAGCACAATGATCACGA
>probe:Drosophila_2:1629458_at:5:651; Interrogation_Position=3118; Antisense; TCACGAACACGATCTGGACCAGGAG
>probe:Drosophila_2:1629458_at:514:453; Interrogation_Position=3184; Antisense; GATCAGCTCCTCGAATCGCGTGGAG
>probe:Drosophila_2:1629458_at:45:297; Interrogation_Position=3259; Antisense; CGAACCGATCGTGGTCAACGAGGAG
>probe:Drosophila_2:1629458_at:582:547; Interrogation_Position=3283; Antisense; GGAGGCCAAGCATTAGTCAGTCACT
>probe:Drosophila_2:1629458_at:28:679; Interrogation_Position=3296; Antisense; TAGTCAGTCACTAGTTAGCATCGAA
>probe:Drosophila_2:1629458_at:127:475; Interrogation_Position=3309; Antisense; GTTAGCATCGAACTCATCAGCGCCG
>probe:Drosophila_2:1629458_at:204:35; Interrogation_Position=3324; Antisense; ATCAGCGCCGCTTGAACCTATTTAT
>probe:Drosophila_2:1629458_at:310:381; Interrogation_Position=3337; Antisense; GAACCTATTTATTGCTGCCTCATCA
>probe:Drosophila_2:1629458_at:690:335; Interrogation_Position=3350; Antisense; GCTGCCTCATCATCATCAACTAAGA
>probe:Drosophila_2:1629458_at:672:425; Interrogation_Position=3385; Antisense; GAGAGCTTAGAGCTCCATCTGTCCC
>probe:Drosophila_2:1629458_at:449:49; Interrogation_Position=3533; Antisense; ATGCGGATCGACGAGGGTATGCCCC
>probe:Drosophila_2:1629458_at:1:389; Interrogation_Position=3565; Antisense; GAAAAGTGCCTTTTCATGCTCGCAG
>probe:Drosophila_2:1629458_at:111:53; Interrogation_Position=3580; Antisense; ATGCTCGCAGCTCGTGTATAAAAGT

Paste this into a BLAST search page for me
GCTCCGATGAGCACAATGATCACGATCACGAACACGATCTGGACCAGGAGGATCAGCTCCTCGAATCGCGTGGAGCGAACCGATCGTGGTCAACGAGGAGGGAGGCCAAGCATTAGTCAGTCACTTAGTCAGTCACTAGTTAGCATCGAAGTTAGCATCGAACTCATCAGCGCCGATCAGCGCCGCTTGAACCTATTTATGAACCTATTTATTGCTGCCTCATCAGCTGCCTCATCATCATCAACTAAGAGAGAGCTTAGAGCTCCATCTGTCCCATGCGGATCGACGAGGGTATGCCCCGAAAAGTGCCTTTTCATGCTCGCAGATGCTCGCAGCTCGTGTATAAAAGT

Full Affymetrix probeset data:

Annotations for 1629458_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720