FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629459_at:

>probe:Drosophila_2:1629459_at:125:579; Interrogation_Position=1089; Antisense; GGCCATCGAGTATGCCAGGCACATC
>probe:Drosophila_2:1629459_at:706:257; Interrogation_Position=1108; Antisense; CACATCGGTGGTGCTTATCCAAGTT
>probe:Drosophila_2:1629459_at:327:367; Interrogation_Position=1198; Antisense; GAATCTGCTGCCGACCGAGAGGCAG
>probe:Drosophila_2:1629459_at:207:305; Interrogation_Position=1226; Antisense; CCGATGCCGACACCTTTGTAGATGT
>probe:Drosophila_2:1629459_at:350:99; Interrogation_Position=1245; Antisense; AGATGTGGTTGGAACCGCACCGGCT
>probe:Drosophila_2:1629459_at:207:123; Interrogation_Position=1330; Antisense; AGCGATCCGACGATGGCCAAGCCGA
>probe:Drosophila_2:1629459_at:407:263; Interrogation_Position=1362; Antisense; CAGCTTCAGCATCTCGGACATATTA
>probe:Drosophila_2:1629459_at:131:379; Interrogation_Position=1388; Antisense; GAACCAGCTCGTCCATTTAAAACTA
>probe:Drosophila_2:1629459_at:687:219; Interrogation_Position=1415; Antisense; AAGTGCAGACGGGTGCATGTGCTCC
>probe:Drosophila_2:1629459_at:378:63; Interrogation_Position=1431; Antisense; ATGTGCTCCCGTTTGGCTTGGAATC
>probe:Drosophila_2:1629459_at:217:565; Interrogation_Position=1450; Antisense; GGAATCGGTGCCTTGTACATTTAAT
>probe:Drosophila_2:1629459_at:27:15; Interrogation_Position=1473; Antisense; ATTAGCGTTTAGTTGCCATCGTCTG
>probe:Drosophila_2:1629459_at:341:271; Interrogation_Position=1489; Antisense; CATCGTCTGCGTAGTGTCTAAGCTG
>probe:Drosophila_2:1629459_at:669:543; Interrogation_Position=1539; Antisense; GGATTTCCAGGTATTTGCCATCAGT

Paste this into a BLAST search page for me
GGCCATCGAGTATGCCAGGCACATCCACATCGGTGGTGCTTATCCAAGTTGAATCTGCTGCCGACCGAGAGGCAGCCGATGCCGACACCTTTGTAGATGTAGATGTGGTTGGAACCGCACCGGCTAGCGATCCGACGATGGCCAAGCCGACAGCTTCAGCATCTCGGACATATTAGAACCAGCTCGTCCATTTAAAACTAAAGTGCAGACGGGTGCATGTGCTCCATGTGCTCCCGTTTGGCTTGGAATCGGAATCGGTGCCTTGTACATTTAATATTAGCGTTTAGTTGCCATCGTCTGCATCGTCTGCGTAGTGTCTAAGCTGGGATTTCCAGGTATTTGCCATCAGT

Full Affymetrix probeset data:

Annotations for 1629459_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720