FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629460_at:

>probe:Drosophila_2:1629460_at:220:253; Interrogation_Position=108; Antisense; CAACCTGATCGCTGGCGGTGGAGTT
>probe:Drosophila_2:1629460_at:336:505; Interrogation_Position=151; Antisense; GTCCAAATGGCCACAATGTCCTGGG
>probe:Drosophila_2:1629460_at:315:387; Interrogation_Position=249; Antisense; GAACACGTATCGCTATGCCGGCCAG
>probe:Drosophila_2:1629460_at:412:609; Interrogation_Position=278; Antisense; TGAGCATTCTCTTCACCCGAAGTGT
>probe:Drosophila_2:1629460_at:455:449; Interrogation_Position=330; Antisense; GATCGCCGCCTGGTTCGATGAGAAT
>probe:Drosophila_2:1629460_at:457:237; Interrogation_Position=352; Antisense; AATCGGGATGCGACCAGTGGCGACA
>probe:Drosophila_2:1629460_at:504:557; Interrogation_Position=381; Antisense; GGACTATCAGATGCGCGGTGGACCA
>probe:Drosophila_2:1629460_at:80:263; Interrogation_Position=420; Antisense; CACCACCATGGTCAACGAGCGAAAT
>probe:Drosophila_2:1629460_at:535:201; Interrogation_Position=445; Antisense; AACCGAGTGGGTTGTGCGATTGCTC
>probe:Drosophila_2:1629460_at:145:463; Interrogation_Position=462; Antisense; GATTGCTCGATTTACGGACGCCAAC
>probe:Drosophila_2:1629460_at:358:357; Interrogation_Position=512; Antisense; GCAACTACGCGGTCACCAATGTGGT
>probe:Drosophila_2:1629460_at:207:335; Interrogation_Position=565; Antisense; GCTGCCTCGGAATGCACTACAGGAC
>probe:Drosophila_2:1629460_at:395:389; Interrogation_Position=590; Antisense; GAAACTCCAACTATCCGAATCTCTG
>probe:Drosophila_2:1629460_at:19:633; Interrogation_Position=616; Antisense; TCGCCCAACGAGGTGTACAACTATA

Paste this into a BLAST search page for me
CAACCTGATCGCTGGCGGTGGAGTTGTCCAAATGGCCACAATGTCCTGGGGAACACGTATCGCTATGCCGGCCAGTGAGCATTCTCTTCACCCGAAGTGTGATCGCCGCCTGGTTCGATGAGAATAATCGGGATGCGACCAGTGGCGACAGGACTATCAGATGCGCGGTGGACCACACCACCATGGTCAACGAGCGAAATAACCGAGTGGGTTGTGCGATTGCTCGATTGCTCGATTTACGGACGCCAACGCAACTACGCGGTCACCAATGTGGTGCTGCCTCGGAATGCACTACAGGACGAAACTCCAACTATCCGAATCTCTGTCGCCCAACGAGGTGTACAACTATA

Full Affymetrix probeset data:

Annotations for 1629460_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720