FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629461_at:

>probe:Drosophila_2:1629461_at:194:641; Interrogation_Position=1017; Antisense; TCTGGATATTTTGTCTAGGCGCGGC
>probe:Drosophila_2:1629461_at:557:679; Interrogation_Position=1032; Antisense; TAGGCGCGGCGTCATGCTAAGCAAA
>probe:Drosophila_2:1629461_at:501:109; Interrogation_Position=1051; Antisense; AGCAAACACTATCCGGAGGTCTTCG
>probe:Drosophila_2:1629461_at:601:415; Interrogation_Position=1075; Antisense; GAGCGCCTGCAAACGTACTCTGAGG
>probe:Drosophila_2:1629461_at:673:199; Interrogation_Position=1203; Antisense; AACGAAGCTTCCATCAGCAGCGGAT
>probe:Drosophila_2:1629461_at:251:547; Interrogation_Position=1224; Antisense; GGATGGCGGCAATCGAGTTACTACC
>probe:Drosophila_2:1629461_at:84:681; Interrogation_Position=1256; Antisense; TAGGATCTACTTCGGCTCTTGTGCA
>probe:Drosophila_2:1629461_at:410:645; Interrogation_Position=1272; Antisense; TCTTGTGCAACTGGAACTGGGCGAT
>probe:Drosophila_2:1629461_at:162:233; Interrogation_Position=759; Antisense; AATGCTCATTTACGTTGCTATTTGC
>probe:Drosophila_2:1629461_at:617:17; Interrogation_Position=778; Antisense; ATTTGCGTGGTATCCGAGGCACCGG
>probe:Drosophila_2:1629461_at:348:501; Interrogation_Position=845; Antisense; GTCGTTGTGCCAAGCTGAAACTCTG
>probe:Drosophila_2:1629461_at:616:201; Interrogation_Position=917; Antisense; AACCGGTGTCTGTTGTGGCAGTGCC
>probe:Drosophila_2:1629461_at:21:513; Interrogation_Position=947; Antisense; GGACGGAAATCCTCATTCTAACTTT
>probe:Drosophila_2:1629461_at:385:699; Interrogation_Position=962; Antisense; TTCTAACTTTCAATCCCGGACAGCA

Paste this into a BLAST search page for me
TCTGGATATTTTGTCTAGGCGCGGCTAGGCGCGGCGTCATGCTAAGCAAAAGCAAACACTATCCGGAGGTCTTCGGAGCGCCTGCAAACGTACTCTGAGGAACGAAGCTTCCATCAGCAGCGGATGGATGGCGGCAATCGAGTTACTACCTAGGATCTACTTCGGCTCTTGTGCATCTTGTGCAACTGGAACTGGGCGATAATGCTCATTTACGTTGCTATTTGCATTTGCGTGGTATCCGAGGCACCGGGTCGTTGTGCCAAGCTGAAACTCTGAACCGGTGTCTGTTGTGGCAGTGCCGGACGGAAATCCTCATTCTAACTTTTTCTAACTTTCAATCCCGGACAGCA

Full Affymetrix probeset data:

Annotations for 1629461_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720