FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629462_at:

>probe:Drosophila_2:1629462_at:325:575; Interrogation_Position=110; Antisense; GGCGGATCCGAGTATCAATGACATC
>probe:Drosophila_2:1629462_at:377:401; Interrogation_Position=129; Antisense; GACATCGATGAGACTGTGGCTCCTC
>probe:Drosophila_2:1629462_at:584:547; Interrogation_Position=159; Antisense; GGAGGCGCTGACAGCTTCGACCTGA
>probe:Drosophila_2:1629462_at:709:715; Interrogation_Position=174; Antisense; TTCGACCTGAACAAGCGGCTAGATT
>probe:Drosophila_2:1629462_at:420:251; Interrogation_Position=185; Antisense; CAAGCGGCTAGATTGCGAGCATTTA
>probe:Drosophila_2:1629462_at:255:293; Interrogation_Position=200; Antisense; CGAGCATTTAGATCAGATGACGGAT
>probe:Drosophila_2:1629462_at:451:461; Interrogation_Position=234; Antisense; GATTATCAAAGACCCTCGTTTGCCA
>probe:Drosophila_2:1629462_at:458:385; Interrogation_Position=261; Antisense; GAACTTCTGCGATTTTTCGGCAACG
>probe:Drosophila_2:1629462_at:430:717; Interrogation_Position=276; Antisense; TTCGGCAACGTATTTGTCGATATAT
>probe:Drosophila_2:1629462_at:79:207; Interrogation_Position=30; Antisense; AAGCTGCCGTAAACACTTTGAAGTG
>probe:Drosophila_2:1629462_at:244:657; Interrogation_Position=302; Antisense; TAATGCGATTTTCAACTGATCTAAT
>probe:Drosophila_2:1629462_at:205:447; Interrogation_Position=319; Antisense; GATCTAATCCGTATACTTGTAACTG
>probe:Drosophila_2:1629462_at:482:469; Interrogation_Position=343; Antisense; GTTGCAGAGCAGTCAATGGTTCCAT
>probe:Drosophila_2:1629462_at:286:163; Interrogation_Position=92; Antisense; AAATTTCTACTTCACCATGGCGGAT

Paste this into a BLAST search page for me
GGCGGATCCGAGTATCAATGACATCGACATCGATGAGACTGTGGCTCCTCGGAGGCGCTGACAGCTTCGACCTGATTCGACCTGAACAAGCGGCTAGATTCAAGCGGCTAGATTGCGAGCATTTACGAGCATTTAGATCAGATGACGGATGATTATCAAAGACCCTCGTTTGCCAGAACTTCTGCGATTTTTCGGCAACGTTCGGCAACGTATTTGTCGATATATAAGCTGCCGTAAACACTTTGAAGTGTAATGCGATTTTCAACTGATCTAATGATCTAATCCGTATACTTGTAACTGGTTGCAGAGCAGTCAATGGTTCCATAAATTTCTACTTCACCATGGCGGAT

Full Affymetrix probeset data:

Annotations for 1629462_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720