FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629466_at:

>probe:Drosophila_2:1629466_at:6:511; Interrogation_Position=1997; Antisense; GTGACGTCTACGATCCTTAAGAGTT
>probe:Drosophila_2:1629466_at:696:375; Interrogation_Position=2027; Antisense; GAAGACCTTATGGACGACTCGGCTA
>probe:Drosophila_2:1629466_at:187:587; Interrogation_Position=2037; Antisense; TGGACGACTCGGCTACTATTGATGA
>probe:Drosophila_2:1629466_at:152:7; Interrogation_Position=2054; Antisense; ATTGATGAGATCTGCAGCGCGGCCT
>probe:Drosophila_2:1629466_at:151:289; Interrogation_Position=2073; Antisense; CGGCCTTGCGAGACGTGGCCAAGAA
>probe:Drosophila_2:1629466_at:322:189; Interrogation_Position=2108; Antisense; AACAGTCGCCGGGTGTTGAACTCGG
>probe:Drosophila_2:1629466_at:191:193; Interrogation_Position=2183; Antisense; AACTCCGATTCCAACATGGTAGTGG
>probe:Drosophila_2:1629466_at:181:521; Interrogation_Position=2204; Antisense; GTGGAAATGAGCTTCGATACCTAGA
>probe:Drosophila_2:1629466_at:319:475; Interrogation_Position=2262; Antisense; GTTAGCTCCTATTGTTAGCCAGACA
>probe:Drosophila_2:1629466_at:322:49; Interrogation_Position=2292; Antisense; ATGCCATGCACTTGAACTTAATTCG
>probe:Drosophila_2:1629466_at:333:53; Interrogation_Position=2341; Antisense; ATGCTTGTATATTGTCGTCTGGCTA
>probe:Drosophila_2:1629466_at:42:89; Interrogation_Position=2374; Antisense; AGTCTTGGGATTTTTCAGCTCTGTT
>probe:Drosophila_2:1629466_at:329:277; Interrogation_Position=2394; Antisense; CTGTTTTTCCCACCATCAATCGAAG
>probe:Drosophila_2:1629466_at:393:373; Interrogation_Position=2415; Antisense; GAAGTCGCCGCCATGTGAATAACAT

Paste this into a BLAST search page for me
GTGACGTCTACGATCCTTAAGAGTTGAAGACCTTATGGACGACTCGGCTATGGACGACTCGGCTACTATTGATGAATTGATGAGATCTGCAGCGCGGCCTCGGCCTTGCGAGACGTGGCCAAGAAAACAGTCGCCGGGTGTTGAACTCGGAACTCCGATTCCAACATGGTAGTGGGTGGAAATGAGCTTCGATACCTAGAGTTAGCTCCTATTGTTAGCCAGACAATGCCATGCACTTGAACTTAATTCGATGCTTGTATATTGTCGTCTGGCTAAGTCTTGGGATTTTTCAGCTCTGTTCTGTTTTTCCCACCATCAATCGAAGGAAGTCGCCGCCATGTGAATAACAT

Full Affymetrix probeset data:

Annotations for 1629466_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720