FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629467_at:

>probe:Drosophila_2:1629467_at:708:661; Interrogation_Position=1494; Antisense; TAACATTGAAACCTCTCGCTTGCTT
>probe:Drosophila_2:1629467_at:698:281; Interrogation_Position=1508; Antisense; CTCGCTTGCTTACATCTGCATCAAA
>probe:Drosophila_2:1629467_at:393:93; Interrogation_Position=1603; Antisense; AGTTCAGCTGAGTCAATCGTTACCG
>probe:Drosophila_2:1629467_at:356:227; Interrogation_Position=1617; Antisense; AATCGTTACCGATCCTCTACTTGTT
>probe:Drosophila_2:1629467_at:51:151; Interrogation_Position=1635; Antisense; ACTTGTTCCTGAGTTTTCTACTGCA
>probe:Drosophila_2:1629467_at:267:711; Interrogation_Position=1662; Antisense; TTCAACCCCATCGACTGGTAGTAAT
>probe:Drosophila_2:1629467_at:433:547; Interrogation_Position=1690; Antisense; GGATGCTCTACTGGAATGGTTTCTG
>probe:Drosophila_2:1629467_at:83:225; Interrogation_Position=1758; Antisense; AAGGCACATTGAAACTCTGACTACA
>probe:Drosophila_2:1629467_at:507:239; Interrogation_Position=1834; Antisense; AATCAGCTGAAAACGTCGCCATCAA
>probe:Drosophila_2:1629467_at:102:3; Interrogation_Position=1905; Antisense; ATTGTCTTCGGCTAATGCATCTTTA
>probe:Drosophila_2:1629467_at:401:345; Interrogation_Position=1921; Antisense; GCATCTTTAACAGCGCAGGAACTTT
>probe:Drosophila_2:1629467_at:143:655; Interrogation_Position=1953; Antisense; TAACCTGTTTAAAGAGCGCCTATGC
>probe:Drosophila_2:1629467_at:712:321; Interrogation_Position=1968; Antisense; GCGCCTATGCGCTTTACAGGGAAAT
>probe:Drosophila_2:1629467_at:243:457; Interrogation_Position=2025; Antisense; GATAGATGCCCCATACGACTTAAGT

Paste this into a BLAST search page for me
TAACATTGAAACCTCTCGCTTGCTTCTCGCTTGCTTACATCTGCATCAAAAGTTCAGCTGAGTCAATCGTTACCGAATCGTTACCGATCCTCTACTTGTTACTTGTTCCTGAGTTTTCTACTGCATTCAACCCCATCGACTGGTAGTAATGGATGCTCTACTGGAATGGTTTCTGAAGGCACATTGAAACTCTGACTACAAATCAGCTGAAAACGTCGCCATCAAATTGTCTTCGGCTAATGCATCTTTAGCATCTTTAACAGCGCAGGAACTTTTAACCTGTTTAAAGAGCGCCTATGCGCGCCTATGCGCTTTACAGGGAAATGATAGATGCCCCATACGACTTAAGT

Full Affymetrix probeset data:

Annotations for 1629467_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720