Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629468_at:

>probe:Drosophila_2:1629468_at:174:291; Interrogation_Position=1122; Antisense; CGGATTGCCAACATGGTGCTCCATA
>probe:Drosophila_2:1629468_at:706:523; Interrogation_Position=1201; Antisense; GGGCGACTATATTCAACACCTACAT
>probe:Drosophila_2:1629468_at:81:189; Interrogation_Position=1215; Antisense; AACACCTACATCTGGCCAGTTTGCA
>probe:Drosophila_2:1629468_at:155:619; Interrogation_Position=1236; Antisense; TGCATGCCGCCCGTGAACGAAGATT
>probe:Drosophila_2:1629468_at:667:455; Interrogation_Position=1266; Antisense; GATAGAAACGCCATTGTCACCGGTT
>probe:Drosophila_2:1629468_at:682:217; Interrogation_Position=1302; Antisense; AAGTTTGGCGGTCCTCATTCTAACA
>probe:Drosophila_2:1629468_at:257:207; Interrogation_Position=1356; Antisense; AAGCAGTCCGATTGCAGGTCGTCAT
>probe:Drosophila_2:1629468_at:6:647; Interrogation_Position=1377; Antisense; TCATTTGTACAGCACGTTCCGGACA
>probe:Drosophila_2:1629468_at:585:627; Interrogation_Position=1403; Antisense; TGCCATGTGCGCTGGATTTCCGGAA
>probe:Drosophila_2:1629468_at:342:497; Interrogation_Position=1432; Antisense; GTCAGGACTCCTGTCAAGGCGATAG
>probe:Drosophila_2:1629468_at:312:121; Interrogation_Position=1455; Antisense; AGCGGAGGTCCTCTGTTGGTACAAC
>probe:Drosophila_2:1629468_at:719:529; Interrogation_Position=1550; Antisense; GGGTATCTACACTCGCGTGGATCGC
>probe:Drosophila_2:1629468_at:292:131; Interrogation_Position=1576; Antisense; ACCTGGACTGGATTTTGGCTAATGC
>probe:Drosophila_2:1629468_at:670:669; Interrogation_Position=1622; Antisense; TACTGTCTTCAGTTCGATGGTACAT

Paste this into a BLAST search page for me
CGGATTGCCAACATGGTGCTCCATAGGGCGACTATATTCAACACCTACATAACACCTACATCTGGCCAGTTTGCATGCATGCCGCCCGTGAACGAAGATTGATAGAAACGCCATTGTCACCGGTTAAGTTTGGCGGTCCTCATTCTAACAAAGCAGTCCGATTGCAGGTCGTCATTCATTTGTACAGCACGTTCCGGACATGCCATGTGCGCTGGATTTCCGGAAGTCAGGACTCCTGTCAAGGCGATAGAGCGGAGGTCCTCTGTTGGTACAACGGGTATCTACACTCGCGTGGATCGCACCTGGACTGGATTTTGGCTAATGCTACTGTCTTCAGTTCGATGGTACAT

Full Affymetrix probeset data:

Annotations for 1629468_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime