Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629470_at:

>probe:Drosophila_2:1629470_at:728:151; Interrogation_Position=397; Antisense; ACATCAAGTATCTGGTGCGCTGGCA
>probe:Drosophila_2:1629470_at:310:325; Interrogation_Position=427; Antisense; GCGACGAGTTCGACTTGGTGCCATC
>probe:Drosophila_2:1629470_at:624:669; Interrogation_Position=513; Antisense; TACTCCCGTCACATTGCGATGCGAA
>probe:Drosophila_2:1629470_at:106:35; Interrogation_Position=631; Antisense; ATCAGTCCGCTGAGTTGGCTGGACA
>probe:Drosophila_2:1629470_at:514:585; Interrogation_Position=650; Antisense; TGGACATCTTGGTGGAATCGCGCCA
>probe:Drosophila_2:1629470_at:616:53; Interrogation_Position=700; Antisense; ATGCACCCATGGATCTAGCCAATGA
>probe:Drosophila_2:1629470_at:483:455; Interrogation_Position=723; Antisense; GATACCGACGATTTGGCTAGTGTTT
>probe:Drosophila_2:1629470_at:400:679; Interrogation_Position=740; Antisense; TAGTGTTTCGTACTCGATTCCCGTG
>probe:Drosophila_2:1629470_at:327:473; Interrogation_Position=836; Antisense; GTTCAGTCTTTAATCTAAGCCCCTA
>probe:Drosophila_2:1629470_at:454:475; Interrogation_Position=879; Antisense; GTATAGCTATCTGAAACCACTGGGT
>probe:Drosophila_2:1629470_at:615:541; Interrogation_Position=901; Antisense; GGTTCGTCCAGATTCATGTGACCCA
>probe:Drosophila_2:1629470_at:572:61; Interrogation_Position=916; Antisense; ATGTGACCCAACTGGCCGGAGCGAA
>probe:Drosophila_2:1629470_at:234:221; Interrogation_Position=943; Antisense; AAGTGAATGAACTTTCGCGCGGCCG
>probe:Drosophila_2:1629470_at:191:323; Interrogation_Position=959; Antisense; GCGCGGCCGCCAATAAATTTGTCAT

Paste this into a BLAST search page for me
ACATCAAGTATCTGGTGCGCTGGCAGCGACGAGTTCGACTTGGTGCCATCTACTCCCGTCACATTGCGATGCGAAATCAGTCCGCTGAGTTGGCTGGACATGGACATCTTGGTGGAATCGCGCCAATGCACCCATGGATCTAGCCAATGAGATACCGACGATTTGGCTAGTGTTTTAGTGTTTCGTACTCGATTCCCGTGGTTCAGTCTTTAATCTAAGCCCCTAGTATAGCTATCTGAAACCACTGGGTGGTTCGTCCAGATTCATGTGACCCAATGTGACCCAACTGGCCGGAGCGAAAAGTGAATGAACTTTCGCGCGGCCGGCGCGGCCGCCAATAAATTTGTCAT

Full Affymetrix probeset data:

Annotations for 1629470_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime