FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629471_at:

>probe:Drosophila_2:1629471_at:131:541; Interrogation_Position=2207; Antisense; GGTTAGTTGCCATCGGCCATCTCTC
>probe:Drosophila_2:1629471_at:282:39; Interrogation_Position=2225; Antisense; ATCTCTCTCGCTTTCATAGATGCCT
>probe:Drosophila_2:1629471_at:510:25; Interrogation_Position=2240; Antisense; ATAGATGCCTGGTCGTTCGGTCCTC
>probe:Drosophila_2:1629471_at:229:281; Interrogation_Position=2262; Antisense; CTCTCACTCCATTTTCGAATAGCTT
>probe:Drosophila_2:1629471_at:484:513; Interrogation_Position=2289; Antisense; GTGTAACATATTCATAGGCCCTTGG
>probe:Drosophila_2:1629471_at:344:49; Interrogation_Position=2304; Antisense; AGGCCCTTGGTGTGTAATCGTTGTA
>probe:Drosophila_2:1629471_at:653:235; Interrogation_Position=2319; Antisense; AATCGTTGTAGAACCAGGCCACCAA
>probe:Drosophila_2:1629471_at:626:69; Interrogation_Position=2334; Antisense; AGGCCACCAACTCAATGCTACATTC
>probe:Drosophila_2:1629471_at:570:723; Interrogation_Position=2377; Antisense; TTGTAATAGTTGCATCCCGGAATCC
>probe:Drosophila_2:1629471_at:115:363; Interrogation_Position=2403; Antisense; GAATTTAAAATTCCTATCGGGCTAG
>probe:Drosophila_2:1629471_at:459:95; Interrogation_Position=2430; Antisense; AGATATTATCGCTCGTTTTGTGTAA
>probe:Drosophila_2:1629471_at:561:145; Interrogation_Position=2485; Antisense; ACTCGATTTGGTGTATTCATTTTGT
>probe:Drosophila_2:1629471_at:522:237; Interrogation_Position=2569; Antisense; AATCTCAATGAAATCGCAAGCGCAA
>probe:Drosophila_2:1629471_at:569:661; Interrogation_Position=2755; Antisense; TAAACTAATTGTATGGCCTATGTAT

Paste this into a BLAST search page for me
GGTTAGTTGCCATCGGCCATCTCTCATCTCTCTCGCTTTCATAGATGCCTATAGATGCCTGGTCGTTCGGTCCTCCTCTCACTCCATTTTCGAATAGCTTGTGTAACATATTCATAGGCCCTTGGAGGCCCTTGGTGTGTAATCGTTGTAAATCGTTGTAGAACCAGGCCACCAAAGGCCACCAACTCAATGCTACATTCTTGTAATAGTTGCATCCCGGAATCCGAATTTAAAATTCCTATCGGGCTAGAGATATTATCGCTCGTTTTGTGTAAACTCGATTTGGTGTATTCATTTTGTAATCTCAATGAAATCGCAAGCGCAATAAACTAATTGTATGGCCTATGTAT

Full Affymetrix probeset data:

Annotations for 1629471_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720