Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629473_at:

>probe:Drosophila_2:1629473_at:540:31; Interrogation_Position=6049; Antisense; ATAATGGCTCCAACTGAAGCATCTT
>probe:Drosophila_2:1629473_at:111:377; Interrogation_Position=6064; Antisense; GAAGCATCTTACTTTACCAACTTAG
>probe:Drosophila_2:1629473_at:299:453; Interrogation_Position=6123; Antisense; GATAAGTGCGAATTCCGTGGCAGTT
>probe:Drosophila_2:1629473_at:571:361; Interrogation_Position=6132; Antisense; GAATTCCGTGGCAGTTGTAGATAAA
>probe:Drosophila_2:1629473_at:687:657; Interrogation_Position=6197; Antisense; TAAGTCGTCCATTTGATCATAACAC
>probe:Drosophila_2:1629473_at:503:453; Interrogation_Position=6211; Antisense; GATCATAACACGTCAACCTCATTGC
>probe:Drosophila_2:1629473_at:723:201; Interrogation_Position=6225; Antisense; AACCTCATTGCATCGTCTTGTTAAT
>probe:Drosophila_2:1629473_at:649:343; Interrogation_Position=6234; Antisense; GCATCGTCTTGTTAATGGGTTCTAA
>probe:Drosophila_2:1629473_at:246:661; Interrogation_Position=6289; Antisense; TAAAATTCATTTCCGGTTGCCAATC
>probe:Drosophila_2:1629473_at:384:631; Interrogation_Position=6300; Antisense; TCCGGTTGCCAATCAATCATTTTAA
>probe:Drosophila_2:1629473_at:581:699; Interrogation_Position=6319; Antisense; TTTTAATGCACTTTACCGACCGACT
>probe:Drosophila_2:1629473_at:52:413; Interrogation_Position=6336; Antisense; GACCGACTTGGGTCGATGACGAATA
>probe:Drosophila_2:1629473_at:623:131; Interrogation_Position=6391; Antisense; ACATTGAAATCGCAGTCCATCCCAG
>probe:Drosophila_2:1629473_at:389:505; Interrogation_Position=6405; Antisense; GTCCATCCCAGACACAAACGAAATT

Paste this into a BLAST search page for me
ATAATGGCTCCAACTGAAGCATCTTGAAGCATCTTACTTTACCAACTTAGGATAAGTGCGAATTCCGTGGCAGTTGAATTCCGTGGCAGTTGTAGATAAATAAGTCGTCCATTTGATCATAACACGATCATAACACGTCAACCTCATTGCAACCTCATTGCATCGTCTTGTTAATGCATCGTCTTGTTAATGGGTTCTAATAAAATTCATTTCCGGTTGCCAATCTCCGGTTGCCAATCAATCATTTTAATTTTAATGCACTTTACCGACCGACTGACCGACTTGGGTCGATGACGAATAACATTGAAATCGCAGTCCATCCCAGGTCCATCCCAGACACAAACGAAATT

Full Affymetrix probeset data:

Annotations for 1629473_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime