FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629474_at:

>probe:Drosophila_2:1629474_at:20:521; Interrogation_Position=120; Antisense; GGGCCTGGATGTGGTCCACCACCAA
>probe:Drosophila_2:1629474_at:191:255; Interrogation_Position=139; Antisense; CACCAAGTGGAACACCTCCGTCGGG
>probe:Drosophila_2:1629474_at:689:127; Interrogation_Position=182; Antisense; ACCACCTGGAGGTCGCTGCGGACCA
>probe:Drosophila_2:1629474_at:159:259; Interrogation_Position=218; Antisense; CACGGCTGCATCTACCGGTTAAATT
>probe:Drosophila_2:1629474_at:130:475; Interrogation_Position=235; Antisense; GTTAAATTTGTCCACCTCTGCGATT
>probe:Drosophila_2:1629474_at:483:39; Interrogation_Position=24; Antisense; ATCTGGACATTTGGCAAGATGCATC
>probe:Drosophila_2:1629474_at:418:143; Interrogation_Position=264; Antisense; ACTCCAATTTCCCTCATAAGGCTTA
>probe:Drosophila_2:1629474_at:701:225; Interrogation_Position=281; Antisense; AAGGCTTACTGAAATGTCACCTAGA
>probe:Drosophila_2:1629474_at:692:227; Interrogation_Position=293; Antisense; AATGTCACCTAGAAAATCCTTTTGT
>probe:Drosophila_2:1629474_at:183:63; Interrogation_Position=365; Antisense; ATGTGTGTATAACTGCTGAATCTAA
>probe:Drosophila_2:1629474_at:30:361; Interrogation_Position=37; Antisense; GCAAGATGCATCTGAACCTGAAATA
>probe:Drosophila_2:1629474_at:681:611; Interrogation_Position=55; Antisense; TGAAATATTTCATTGGTCTGCTACT
>probe:Drosophila_2:1629474_at:185:535; Interrogation_Position=69; Antisense; GGTCTGCTACTGGTGCTGCTTTGCA
>probe:Drosophila_2:1629474_at:62:695; Interrogation_Position=88; Antisense; TTTGCAGCTCTTTTGCGGTGGCCTA

Paste this into a BLAST search page for me
GGGCCTGGATGTGGTCCACCACCAACACCAAGTGGAACACCTCCGTCGGGACCACCTGGAGGTCGCTGCGGACCACACGGCTGCATCTACCGGTTAAATTGTTAAATTTGTCCACCTCTGCGATTATCTGGACATTTGGCAAGATGCATCACTCCAATTTCCCTCATAAGGCTTAAAGGCTTACTGAAATGTCACCTAGAAATGTCACCTAGAAAATCCTTTTGTATGTGTGTATAACTGCTGAATCTAAGCAAGATGCATCTGAACCTGAAATATGAAATATTTCATTGGTCTGCTACTGGTCTGCTACTGGTGCTGCTTTGCATTTGCAGCTCTTTTGCGGTGGCCTA

Full Affymetrix probeset data:

Annotations for 1629474_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720