FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629475_at:

>probe:Drosophila_2:1629475_at:485:105; Interrogation_Position=1025; Antisense; AGAAGGAGTTGGGTCTTCCCACCAG
>probe:Drosophila_2:1629475_at:547:115; Interrogation_Position=1094; Antisense; AGCATCCTGAGATGGACTTCTCCAA
>probe:Drosophila_2:1629475_at:274:491; Interrogation_Position=1157; Antisense; GTAAACTTTCGATTTCGCACTCTTG
>probe:Drosophila_2:1629475_at:192:297; Interrogation_Position=1172; Antisense; CGCACTCTTGTCACTTTTACACATT
>probe:Drosophila_2:1629475_at:21:645; Interrogation_Position=1208; Antisense; TCTTTTTCATTTTCCAACCACACAA
>probe:Drosophila_2:1629475_at:491:519; Interrogation_Position=679; Antisense; GTGGAGCTCAAGATTCCGTTCAACT
>probe:Drosophila_2:1629475_at:193:469; Interrogation_Position=696; Antisense; GTTCAACTTAACATTCGGTCTACGC
>probe:Drosophila_2:1629475_at:506:671; Interrogation_Position=716; Antisense; TACGCGCCCGTGATCTAGTGATCAG
>probe:Drosophila_2:1629475_at:320:651; Interrogation_Position=770; Antisense; TCAAAGGTCAAACGCCCATCATCGA
>probe:Drosophila_2:1629475_at:640:647; Interrogation_Position=788; Antisense; TCATCGATGGCGAACTGTGCGGCGA
>probe:Drosophila_2:1629475_at:45:433; Interrogation_Position=826; Antisense; GAGTCCGTGTGGGTCTTGCAAGACA
>probe:Drosophila_2:1629475_at:315:53; Interrogation_Position=889; Antisense; ATGAACTGGTGGAGCCGCCTGGTCA
>probe:Drosophila_2:1629475_at:239:449; Interrogation_Position=919; Antisense; GATCCAGAGATCTCGACGCGCAAGA
>probe:Drosophila_2:1629475_at:603:99; Interrogation_Position=951; Antisense; AGAGTCTTCCAAGCTTTCTGATCTG

Paste this into a BLAST search page for me
AGAAGGAGTTGGGTCTTCCCACCAGAGCATCCTGAGATGGACTTCTCCAAGTAAACTTTCGATTTCGCACTCTTGCGCACTCTTGTCACTTTTACACATTTCTTTTTCATTTTCCAACCACACAAGTGGAGCTCAAGATTCCGTTCAACTGTTCAACTTAACATTCGGTCTACGCTACGCGCCCGTGATCTAGTGATCAGTCAAAGGTCAAACGCCCATCATCGATCATCGATGGCGAACTGTGCGGCGAGAGTCCGTGTGGGTCTTGCAAGACAATGAACTGGTGGAGCCGCCTGGTCAGATCCAGAGATCTCGACGCGCAAGAAGAGTCTTCCAAGCTTTCTGATCTG

Full Affymetrix probeset data:

Annotations for 1629475_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720