FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629476_at:

>probe:Drosophila_2:1629476_at:401:85; Interrogation_Position=341; Antisense; AGTGCACTCGAACTATATGGCCAGC
>probe:Drosophila_2:1629476_at:69:687; Interrogation_Position=354; Antisense; TATATGGCCAGCACGGTGGTCAACG
>probe:Drosophila_2:1629476_at:368:519; Interrogation_Position=369; Antisense; GTGGTCAACGACATCTCGCTTATTC
>probe:Drosophila_2:1629476_at:343:691; Interrogation_Position=405; Antisense; TTTGTGGGTTTCACTGATCGCATCC
>probe:Drosophila_2:1629476_at:124:615; Interrogation_Position=454; Antisense; TGAATGGCCAGTTTCCCACGTACGA
>probe:Drosophila_2:1629476_at:366:377; Interrogation_Position=513; Antisense; GAAAGCGATGCCTCCGACTCGGTTT
>probe:Drosophila_2:1629476_at:276:519; Interrogation_Position=555; Antisense; GTGGAGATGCCCATTATGCCTCACT
>probe:Drosophila_2:1629476_at:459:97; Interrogation_Position=619; Antisense; AGATGATCTGCATGAGCACCACCAG
>probe:Drosophila_2:1629476_at:524:631; Interrogation_Position=677; Antisense; TCCGCTGGTCTACAAGCAGGGCAAC
>probe:Drosophila_2:1629476_at:205:567; Interrogation_Position=696; Antisense; GGCAACTCCAGCTACCTGATCGGAT
>probe:Drosophila_2:1629476_at:166:259; Interrogation_Position=722; Antisense; CACCTCTTTTGGAACCTCTATGGGA
>probe:Drosophila_2:1629476_at:541:427; Interrogation_Position=745; Antisense; GATGTCAAGTGGGATTCCCGGCCGT
>probe:Drosophila_2:1629476_at:302:147; Interrogation_Position=790; Antisense; ACTTGGACTGGATCCTTAACCATAT
>probe:Drosophila_2:1629476_at:630:275; Interrogation_Position=804; Antisense; CTTAACCATATCATCGCCCATAATA

Paste this into a BLAST search page for me
AGTGCACTCGAACTATATGGCCAGCTATATGGCCAGCACGGTGGTCAACGGTGGTCAACGACATCTCGCTTATTCTTTGTGGGTTTCACTGATCGCATCCTGAATGGCCAGTTTCCCACGTACGAGAAAGCGATGCCTCCGACTCGGTTTGTGGAGATGCCCATTATGCCTCACTAGATGATCTGCATGAGCACCACCAGTCCGCTGGTCTACAAGCAGGGCAACGGCAACTCCAGCTACCTGATCGGATCACCTCTTTTGGAACCTCTATGGGAGATGTCAAGTGGGATTCCCGGCCGTACTTGGACTGGATCCTTAACCATATCTTAACCATATCATCGCCCATAATA

Full Affymetrix probeset data:

Annotations for 1629476_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720