FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629478_at:

>probe:Drosophila_2:1629478_at:160:3; Interrogation_Position=105; Antisense; ATTGGCCACCAGGACAGTACGAAGT
>probe:Drosophila_2:1629478_at:667:217; Interrogation_Position=126; Antisense; AAGTACCATTGCTCAGGTGCGTGGC
>probe:Drosophila_2:1629478_at:638:507; Interrogation_Position=245; Antisense; GTGCTCACCTGATGCTTAAATCCGC
>probe:Drosophila_2:1629478_at:593:625; Interrogation_Position=271; Antisense; TGCCAGACCAAGTTTTGCCCGGAAT
>probe:Drosophila_2:1629478_at:372:595; Interrogation_Position=302; Antisense; TGGGCCTGGACATCAAGCACACGGA
>probe:Drosophila_2:1629478_at:563:547; Interrogation_Position=324; Antisense; GGATGTGCTAATCCTGTCGCAGTAT
>probe:Drosophila_2:1629478_at:497:89; Interrogation_Position=344; Antisense; AGTATGTCCGTTCCGACGGCTGTAT
>probe:Drosophila_2:1629478_at:584:139; Interrogation_Position=359; Antisense; ACGGCTGTATGCTGCCCAGAAGGAT
>probe:Drosophila_2:1629478_at:342:309; Interrogation_Position=374; Antisense; CCAGAAGGATCACCGGACTTTGCCA
>probe:Drosophila_2:1629478_at:522:441; Interrogation_Position=414; Antisense; GATGGGCACTCTGGTAACCATGGCT
>probe:Drosophila_2:1629478_at:36:659; Interrogation_Position=428; Antisense; TAACCATGGCTCAGAAGGCGGGACT
>probe:Drosophila_2:1629478_at:534:237; Interrogation_Position=460; Antisense; AATCTGGCGCCCGAGTGGAGTAAAA
>probe:Drosophila_2:1629478_at:80:187; Interrogation_Position=520; Antisense; AACAAGTACTTCCTGGAGTCCACAA
>probe:Drosophila_2:1629478_at:717:61; Interrogation_Position=88; Antisense; ATGTCCTTTGTGTTGCAATTGGCCA

Paste this into a BLAST search page for me
ATTGGCCACCAGGACAGTACGAAGTAAGTACCATTGCTCAGGTGCGTGGCGTGCTCACCTGATGCTTAAATCCGCTGCCAGACCAAGTTTTGCCCGGAATTGGGCCTGGACATCAAGCACACGGAGGATGTGCTAATCCTGTCGCAGTATAGTATGTCCGTTCCGACGGCTGTATACGGCTGTATGCTGCCCAGAAGGATCCAGAAGGATCACCGGACTTTGCCAGATGGGCACTCTGGTAACCATGGCTTAACCATGGCTCAGAAGGCGGGACTAATCTGGCGCCCGAGTGGAGTAAAAAACAAGTACTTCCTGGAGTCCACAAATGTCCTTTGTGTTGCAATTGGCCA

Full Affymetrix probeset data:

Annotations for 1629478_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720