Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629485_at:

>probe:Drosophila_2:1629485_at:727:627; Interrogation_Position=1309; Antisense; TGCCAGTGCACCCAAGGTAGTAAAG
>probe:Drosophila_2:1629485_at:12:91; Interrogation_Position=1327; Antisense; AGTAAAGGCTCCCATTGTCGGCAAT
>probe:Drosophila_2:1629485_at:316:369; Interrogation_Position=1355; Antisense; GAATGCTTTCGAGCCAATGCCCACT
>probe:Drosophila_2:1629485_at:130:649; Interrogation_Position=1394; Antisense; TCAAACCGAACGTTTTGCGCCGGCA
>probe:Drosophila_2:1629485_at:675:523; Interrogation_Position=1452; Antisense; GGGCGAGCATTTACACCGGTATATC
>probe:Drosophila_2:1629485_at:397:713; Interrogation_Position=1490; Antisense; TTCATCCGCCGGAACAATCGCTGGA
>probe:Drosophila_2:1629485_at:183:45; Interrogation_Position=1506; Antisense; ATCGCTGGATGCTGCGTGGCACAGT
>probe:Drosophila_2:1629485_at:539:155; Interrogation_Position=1556; Antisense; ACACCGGATGCGGAATCTAGCCATA
>probe:Drosophila_2:1629485_at:304:367; Interrogation_Position=1568; Antisense; GAATCTAGCCATAAGCTTTGCTGTA
>probe:Drosophila_2:1629485_at:682:23; Interrogation_Position=1609; Antisense; ATATGCCGACGTGGCCAAGTTTCTG
>probe:Drosophila_2:1629485_at:492:585; Interrogation_Position=1632; Antisense; TGGACTGGATCACGGCCTTTGTAAT
>probe:Drosophila_2:1629485_at:538:681; Interrogation_Position=1678; Antisense; TATGGGAACGCATTTCTAAGTGAGC
>probe:Drosophila_2:1629485_at:385:511; Interrogation_Position=1697; Antisense; GTGAGCGCTGTGATAATAGCCCCTT
>probe:Drosophila_2:1629485_at:531:653; Interrogation_Position=1710; Antisense; TAATAGCCCCTTGGGCATGGCGATG

Paste this into a BLAST search page for me
TGCCAGTGCACCCAAGGTAGTAAAGAGTAAAGGCTCCCATTGTCGGCAATGAATGCTTTCGAGCCAATGCCCACTTCAAACCGAACGTTTTGCGCCGGCAGGGCGAGCATTTACACCGGTATATCTTCATCCGCCGGAACAATCGCTGGAATCGCTGGATGCTGCGTGGCACAGTACACCGGATGCGGAATCTAGCCATAGAATCTAGCCATAAGCTTTGCTGTAATATGCCGACGTGGCCAAGTTTCTGTGGACTGGATCACGGCCTTTGTAATTATGGGAACGCATTTCTAAGTGAGCGTGAGCGCTGTGATAATAGCCCCTTTAATAGCCCCTTGGGCATGGCGATG

Full Affymetrix probeset data:

Annotations for 1629485_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime