Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629486_at:

>probe:Drosophila_2:1629486_at:485:93; Interrogation_Position=600; Antisense; AGTTCGCTTCGCCTCTTATCTCGTA
>probe:Drosophila_2:1629486_at:141:643; Interrogation_Position=618; Antisense; TCTCGTACGCCTATTGAAATGCTCA
>probe:Drosophila_2:1629486_at:379:231; Interrogation_Position=635; Antisense; AATGCTCAGGAATAGGCCACCACGA
>probe:Drosophila_2:1629486_at:403:399; Interrogation_Position=658; Antisense; GACCCGATAATTGCCGTTAGTTGTT
>probe:Drosophila_2:1629486_at:105:367; Interrogation_Position=709; Antisense; GAATGAATATCGAGTTGGCTTCTAT
>probe:Drosophila_2:1629486_at:278:583; Interrogation_Position=724; Antisense; TGGCTTCTATTATGTTTGGCAATGC
>probe:Drosophila_2:1629486_at:216:729; Interrogation_Position=739; Antisense; TTGGCAATGCGTGTGCTTCATTACC
>probe:Drosophila_2:1629486_at:613:515; Interrogation_Position=749; Antisense; GTGTGCTTCATTACCTATAACCTAT
>probe:Drosophila_2:1629486_at:61:97; Interrogation_Position=783; Antisense; AGATCTGTCGGGTTAGAGTGTTAAT
>probe:Drosophila_2:1629486_at:481:653; Interrogation_Position=816; Antisense; TAATCAACCCTGCAGTTTTGCTGTC
>probe:Drosophila_2:1629486_at:338:723; Interrogation_Position=833; Antisense; TTGCTGTCCGTAACCATTATTTTGA
>probe:Drosophila_2:1629486_at:680:379; Interrogation_Position=876; Antisense; GAACCACCTATAAGTATGACAATCG
>probe:Drosophila_2:1629486_at:588:43; Interrogation_Position=897; Antisense; ATCGACTGAATGTCCCAATCTACAT
>probe:Drosophila_2:1629486_at:612:523; Interrogation_Position=940; Antisense; GGGCGCAAATTTACATAACACATAA

Paste this into a BLAST search page for me
AGTTCGCTTCGCCTCTTATCTCGTATCTCGTACGCCTATTGAAATGCTCAAATGCTCAGGAATAGGCCACCACGAGACCCGATAATTGCCGTTAGTTGTTGAATGAATATCGAGTTGGCTTCTATTGGCTTCTATTATGTTTGGCAATGCTTGGCAATGCGTGTGCTTCATTACCGTGTGCTTCATTACCTATAACCTATAGATCTGTCGGGTTAGAGTGTTAATTAATCAACCCTGCAGTTTTGCTGTCTTGCTGTCCGTAACCATTATTTTGAGAACCACCTATAAGTATGACAATCGATCGACTGAATGTCCCAATCTACATGGGCGCAAATTTACATAACACATAA

Full Affymetrix probeset data:

Annotations for 1629486_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime