Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629487_at:

>probe:Drosophila_2:1629487_at:422:491; Interrogation_Position=1024; Antisense; GTACAAATCCATCGAGCTGCCAAAG
>probe:Drosophila_2:1629487_at:457:175; Interrogation_Position=1098; Antisense; AAACCGGCTGTGATCTATTGGACAA
>probe:Drosophila_2:1629487_at:134:163; Interrogation_Position=1121; Antisense; AAATTGCTGACCCTTGATCCCAAGA
>probe:Drosophila_2:1629487_at:155:347; Interrogation_Position=1149; Antisense; GCATCGATGCGGACACAGCTCTGAA
>probe:Drosophila_2:1629487_at:92:365; Interrogation_Position=1171; Antisense; GAATCACGACTTCTTCTGGACGGAT
>probe:Drosophila_2:1629487_at:84:103; Interrogation_Position=1239; Antisense; AGAGCATGTTCGAGTACCTGGCGCA
>probe:Drosophila_2:1629487_at:470:379; Interrogation_Position=1321; Antisense; GAAGCCCCAGGACAACAGTATGATT
>probe:Drosophila_2:1629487_at:532:5; Interrogation_Position=1343; Antisense; ATTGACCGGGTTTGGTAGACTGCCA
>probe:Drosophila_2:1629487_at:260:601; Interrogation_Position=1372; Antisense; TGTACGCACCCGACTAATAGTTTCT
>probe:Drosophila_2:1629487_at:394:475; Interrogation_Position=1391; Antisense; GTTTCTCACCTTCAACTAGCGTTAG
>probe:Drosophila_2:1629487_at:564:729; Interrogation_Position=1444; Antisense; TTGGCATTTGCATTAGCGCTTGCTC
>probe:Drosophila_2:1629487_at:269:297; Interrogation_Position=1460; Antisense; CGCTTGCTCCAAATATACCTACATT
>probe:Drosophila_2:1629487_at:710:31; Interrogation_Position=893; Antisense; ATAATGGCCGAGATGTGGACACGCT
>probe:Drosophila_2:1629487_at:243:659; Interrogation_Position=954; Antisense; TAACCTTTATCTCGCAGCTATGCGG

Paste this into a BLAST search page for me
GTACAAATCCATCGAGCTGCCAAAGAAACCGGCTGTGATCTATTGGACAAAAATTGCTGACCCTTGATCCCAAGAGCATCGATGCGGACACAGCTCTGAAGAATCACGACTTCTTCTGGACGGATAGAGCATGTTCGAGTACCTGGCGCAGAAGCCCCAGGACAACAGTATGATTATTGACCGGGTTTGGTAGACTGCCATGTACGCACCCGACTAATAGTTTCTGTTTCTCACCTTCAACTAGCGTTAGTTGGCATTTGCATTAGCGCTTGCTCCGCTTGCTCCAAATATACCTACATTATAATGGCCGAGATGTGGACACGCTTAACCTTTATCTCGCAGCTATGCGG

Full Affymetrix probeset data:

Annotations for 1629487_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime