FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629489_at:

>probe:Drosophila_2:1629489_at:594:237; Interrogation_Position=1449; Antisense; AATCTCGATCGCAGTTTGGATCTAC
>probe:Drosophila_2:1629489_at:135:545; Interrogation_Position=1466; Antisense; GGATCTACTGCAGCGTCATTCAGAT
>probe:Drosophila_2:1629489_at:111:275; Interrogation_Position=1514; Antisense; CATTCCTCCTGTCGATGAATCGTTA
>probe:Drosophila_2:1629489_at:509:39; Interrogation_Position=1532; Antisense; ATCGTTACTTACTACTCTACAGCAC
>probe:Drosophila_2:1629489_at:264:153; Interrogation_Position=1550; Antisense; ACAGCACCTTGGATTTTCGGAGATT
>probe:Drosophila_2:1629489_at:487:95; Interrogation_Position=1570; Antisense; AGATTTCCGCTCGAGATGCTTTGGA
>probe:Drosophila_2:1629489_at:499:445; Interrogation_Position=1584; Antisense; GATGCTTTGGAAACTACGGGCAACA
>probe:Drosophila_2:1629489_at:251:291; Interrogation_Position=1600; Antisense; CGGGCAACAGTTTCCATAAATCTCT
>probe:Drosophila_2:1629489_at:251:541; Interrogation_Position=1700; Antisense; GGTTCAAGAACCTACGAGCTCAACT
>probe:Drosophila_2:1629489_at:97:137; Interrogation_Position=1713; Antisense; ACGAGCTCAACTAATGCGACTGCAA
>probe:Drosophila_2:1629489_at:222:223; Interrogation_Position=1773; Antisense; AAGGTGAACTTGCTCCAGACTGTCC
>probe:Drosophila_2:1629489_at:370:265; Interrogation_Position=1788; Antisense; CAGACTGTCCTTAGCGAGGCCAAGT
>probe:Drosophila_2:1629489_at:349:145; Interrogation_Position=1876; Antisense; ACTACTTAAACTTGCCCTTGGATCA
>probe:Drosophila_2:1629489_at:312:91; Interrogation_Position=1921; Antisense; AGTATAAACGTTTGCTCGAGGGCTA

Paste this into a BLAST search page for me
AATCTCGATCGCAGTTTGGATCTACGGATCTACTGCAGCGTCATTCAGATCATTCCTCCTGTCGATGAATCGTTAATCGTTACTTACTACTCTACAGCACACAGCACCTTGGATTTTCGGAGATTAGATTTCCGCTCGAGATGCTTTGGAGATGCTTTGGAAACTACGGGCAACACGGGCAACAGTTTCCATAAATCTCTGGTTCAAGAACCTACGAGCTCAACTACGAGCTCAACTAATGCGACTGCAAAAGGTGAACTTGCTCCAGACTGTCCCAGACTGTCCTTAGCGAGGCCAAGTACTACTTAAACTTGCCCTTGGATCAAGTATAAACGTTTGCTCGAGGGCTA

Full Affymetrix probeset data:

Annotations for 1629489_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720