FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629491_at:

>probe:Drosophila_2:1629491_at:301:117; Interrogation_Position=1041; Antisense; AGCTTCATTTGTGCCGGCGGAGAAG
>probe:Drosophila_2:1629491_at:124:269; Interrogation_Position=1174; Antisense; CAGGAGTTCCGGGTGTCTATGTCAA
>probe:Drosophila_2:1629491_at:604:599; Interrogation_Position=1187; Antisense; TGTCTATGTCAATGTGGGCACCTAT
>probe:Drosophila_2:1629491_at:330:303; Interrogation_Position=1216; Antisense; CCTGGATCCAAACAACGCTGACGTT
>probe:Drosophila_2:1629491_at:581:445; Interrogation_Position=690; Antisense; GATGCTGCCAGTACGAGCGAACCGA
>probe:Drosophila_2:1629491_at:115:465; Interrogation_Position=713; Antisense; GATTCCCGCCCAGGATGTGTACATC
>probe:Drosophila_2:1629491_at:247:369; Interrogation_Position=740; Antisense; GAATGTGTACGTCAATCCGTCCTTC
>probe:Drosophila_2:1629491_at:182:631; Interrogation_Position=759; Antisense; TCCTTCAATCCCAACAATCTGCAGA
>probe:Drosophila_2:1629491_at:125:39; Interrogation_Position=775; Antisense; ATCTGCAGAACGATGTGGCCATCCT
>probe:Drosophila_2:1629491_at:266:523; Interrogation_Position=789; Antisense; GTGGCCATCCTGAAGTTGTCCACAC
>probe:Drosophila_2:1629491_at:621:609; Interrogation_Position=823; Antisense; TGACCAGCAAATCCACTGTGGGCAC
>probe:Drosophila_2:1629491_at:216:359; Interrogation_Position=904; Antisense; GCAAGAATGACTTCGGTGCCACCGG
>probe:Drosophila_2:1629491_at:548:131; Interrogation_Position=924; Antisense; ACCGGAGCGTACCAGGCCATTGAGA
>probe:Drosophila_2:1629491_at:113:73; Interrogation_Position=948; Antisense; AGGCAAGTGGATGTGCCCCTGATTC

Paste this into a BLAST search page for me
AGCTTCATTTGTGCCGGCGGAGAAGCAGGAGTTCCGGGTGTCTATGTCAATGTCTATGTCAATGTGGGCACCTATCCTGGATCCAAACAACGCTGACGTTGATGCTGCCAGTACGAGCGAACCGAGATTCCCGCCCAGGATGTGTACATCGAATGTGTACGTCAATCCGTCCTTCTCCTTCAATCCCAACAATCTGCAGAATCTGCAGAACGATGTGGCCATCCTGTGGCCATCCTGAAGTTGTCCACACTGACCAGCAAATCCACTGTGGGCACGCAAGAATGACTTCGGTGCCACCGGACCGGAGCGTACCAGGCCATTGAGAAGGCAAGTGGATGTGCCCCTGATTC

Full Affymetrix probeset data:

Annotations for 1629491_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720