Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629493_at:

>probe:Drosophila_2:1629493_at:311:185; Interrogation_Position=2779; Antisense; AAAATTCTGGCTACCTTCAGCACAG
>probe:Drosophila_2:1629493_at:620:179; Interrogation_Position=2808; Antisense; AAACATTTTCTCTTCGCTAGTGGTC
>probe:Drosophila_2:1629493_at:273:259; Interrogation_Position=2835; Antisense; GACCCCACCGACTTTTATGGGACAT
>probe:Drosophila_2:1629493_at:292:415; Interrogation_Position=2884; Antisense; GACCAACATTTGTATTGCCTGCGAT
>probe:Drosophila_2:1629493_at:105:413; Interrogation_Position=2918; Antisense; GACCGGGTGGCAAATCTGTTGAGCT
>probe:Drosophila_2:1629493_at:515:725; Interrogation_Position=2942; Antisense; TTGAGCTGCACTGGAAGGTCGATGT
>probe:Drosophila_2:1629493_at:177:687; Interrogation_Position=2978; Antisense; TATATGCCACGCCAACTTTGCTAAC
>probe:Drosophila_2:1629493_at:329:353; Interrogation_Position=3006; Antisense; GCAGCCGAACGGTCTTTTGGTTTGG
>probe:Drosophila_2:1629493_at:137:439; Interrogation_Position=3043; Antisense; GATGGACGCGTCATGCTGATAAACT
>probe:Drosophila_2:1629493_at:354:537; Interrogation_Position=3106; Antisense; GGTCAAGTCTTTTCCAGTGCATGCT
>probe:Drosophila_2:1629493_at:168:347; Interrogation_Position=3124; Antisense; GCATGCTTTATTGAGGACCTGCGTC
>probe:Drosophila_2:1629493_at:331:405; Interrogation_Position=3139; Antisense; GACCTGCGTCGTGTTTTCGTGGGAT
>probe:Drosophila_2:1629493_at:615:447; Interrogation_Position=3161; Antisense; GATGCCGAGACAATTTCCTTTACTG
>probe:Drosophila_2:1629493_at:148:717; Interrogation_Position=3175; Antisense; TTCCTTTACTGTCTGGGCATCTAGA

Paste this into a BLAST search page for me
AAAATTCTGGCTACCTTCAGCACAGAAACATTTTCTCTTCGCTAGTGGTCGACCCCACCGACTTTTATGGGACATGACCAACATTTGTATTGCCTGCGATGACCGGGTGGCAAATCTGTTGAGCTTTGAGCTGCACTGGAAGGTCGATGTTATATGCCACGCCAACTTTGCTAACGCAGCCGAACGGTCTTTTGGTTTGGGATGGACGCGTCATGCTGATAAACTGGTCAAGTCTTTTCCAGTGCATGCTGCATGCTTTATTGAGGACCTGCGTCGACCTGCGTCGTGTTTTCGTGGGATGATGCCGAGACAATTTCCTTTACTGTTCCTTTACTGTCTGGGCATCTAGA

Full Affymetrix probeset data:

Annotations for 1629493_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime