Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629496_at:

>probe:Drosophila_2:1629496_at:724:167; Interrogation_Position=3652; Antisense; AAATGTGTTCGACACGCTGTCAGAC
>probe:Drosophila_2:1629496_at:582:333; Interrogation_Position=3667; Antisense; GCTGTCAGACGATGCCTTCAACGAG
>probe:Drosophila_2:1629496_at:491:253; Interrogation_Position=3685; Antisense; CAACGAGCTGTTCCAATCCGTGCAA
>probe:Drosophila_2:1629496_at:321:235; Interrogation_Position=3699; Antisense; AATCCGTGCAACAAGCCGAGTGCGA
>probe:Drosophila_2:1629496_at:458:555; Interrogation_Position=3742; Antisense; GGACCGGGCCTTACAGCAGACAATG
>probe:Drosophila_2:1629496_at:197:557; Interrogation_Position=3778; Antisense; GGACAGCGCCTTTCTTAACGATTTC
>probe:Drosophila_2:1629496_at:387:659; Interrogation_Position=3793; Antisense; TAACGATTTCCTGGACGTCGGCGAC
>probe:Drosophila_2:1629496_at:640:445; Interrogation_Position=3830; Antisense; GATGCTGTGATGCACTCACCAAACA
>probe:Drosophila_2:1629496_at:292:727; Interrogation_Position=3944; Antisense; TTGGTGCAGACCTAATTCCGGCATC
>probe:Drosophila_2:1629496_at:190:537; Interrogation_Position=3970; Antisense; GGTCGGATTTATGGCCTACAGAATT
>probe:Drosophila_2:1629496_at:12:461; Interrogation_Position=4038; Antisense; GATTTCCCATTCACTTTTAGGCAGT
>probe:Drosophila_2:1629496_at:410:701; Interrogation_Position=4089; Antisense; TTTTGGCCATTTCTTACCTGCGATT
>probe:Drosophila_2:1629496_at:182:307; Interrogation_Position=4105; Antisense; CCTGCGATTCTAGTTTGGCACAATG
>probe:Drosophila_2:1629496_at:706:473; Interrogation_Position=4150; Antisense; GTTATGCATGCATTCACCAGCAGAT

Paste this into a BLAST search page for me
AAATGTGTTCGACACGCTGTCAGACGCTGTCAGACGATGCCTTCAACGAGCAACGAGCTGTTCCAATCCGTGCAAAATCCGTGCAACAAGCCGAGTGCGAGGACCGGGCCTTACAGCAGACAATGGGACAGCGCCTTTCTTAACGATTTCTAACGATTTCCTGGACGTCGGCGACGATGCTGTGATGCACTCACCAAACATTGGTGCAGACCTAATTCCGGCATCGGTCGGATTTATGGCCTACAGAATTGATTTCCCATTCACTTTTAGGCAGTTTTTGGCCATTTCTTACCTGCGATTCCTGCGATTCTAGTTTGGCACAATGGTTATGCATGCATTCACCAGCAGAT

Full Affymetrix probeset data:

Annotations for 1629496_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime