FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629497_at:

>probe:Drosophila_2:1629497_at:138:453; Interrogation_Position=2399; Antisense; GATCTCTGTCGGGTGAGCAGGTACA
>probe:Drosophila_2:1629497_at:425:609; Interrogation_Position=2412; Antisense; TGAGCAGGTACAGAGCACCGCCTTG
>probe:Drosophila_2:1629497_at:30:263; Interrogation_Position=2449; Antisense; CAGCGTAGCTGTGGCCCTCGATTGA
>probe:Drosophila_2:1629497_at:287:637; Interrogation_Position=2466; Antisense; TCGATTGAGTTCCACTAATCCCGTG
>probe:Drosophila_2:1629497_at:207:455; Interrogation_Position=2520; Antisense; GATCAAGAACTATTCGTCCAACGGA
>probe:Drosophila_2:1629497_at:493:447; Interrogation_Position=2560; Antisense; GATGCGCGACCGGAAGTGGCTAACT
>probe:Drosophila_2:1629497_at:30:191; Interrogation_Position=2632; Antisense; AACATTGCGGCCACAGCAGGCGGTT
>probe:Drosophila_2:1629497_at:582:663; Interrogation_Position=2679; Antisense; TAAAGGACCACCCTTGATTGCTCCG
>probe:Drosophila_2:1629497_at:461:659; Interrogation_Position=2726; Antisense; TAACCCGCACTAAATCCGAGATCGA
>probe:Drosophila_2:1629497_at:485:45; Interrogation_Position=2739; Antisense; ATCCGAGATCGACAGCACAGGCATG
>probe:Drosophila_2:1629497_at:179:219; Interrogation_Position=2791; Antisense; AAGTCGAATGGTCCGAGGTTGCCCA
>probe:Drosophila_2:1629497_at:205:469; Interrogation_Position=2808; Antisense; GTTGCCCATTAGCATATCCGTGCAG
>probe:Drosophila_2:1629497_at:37:673; Interrogation_Position=2922; Antisense; TACCGCCCTGGCCAATAAGCTGAAT
>probe:Drosophila_2:1629497_at:403:229; Interrogation_Position=2944; Antisense; AATGGTTCCACGCTGATGGTTCCTG

Paste this into a BLAST search page for me
GATCTCTGTCGGGTGAGCAGGTACATGAGCAGGTACAGAGCACCGCCTTGCAGCGTAGCTGTGGCCCTCGATTGATCGATTGAGTTCCACTAATCCCGTGGATCAAGAACTATTCGTCCAACGGAGATGCGCGACCGGAAGTGGCTAACTAACATTGCGGCCACAGCAGGCGGTTTAAAGGACCACCCTTGATTGCTCCGTAACCCGCACTAAATCCGAGATCGAATCCGAGATCGACAGCACAGGCATGAAGTCGAATGGTCCGAGGTTGCCCAGTTGCCCATTAGCATATCCGTGCAGTACCGCCCTGGCCAATAAGCTGAATAATGGTTCCACGCTGATGGTTCCTG

Full Affymetrix probeset data:

Annotations for 1629497_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720