Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629498_at:

>probe:Drosophila_2:1629498_at:421:93; Interrogation_Position=2925; Antisense; AGTTCACTCTGGTCCTTGTGCAGCA
>probe:Drosophila_2:1629498_at:395:375; Interrogation_Position=2964; Antisense; GAAGATGCCCAGATACTGCCTATTC
>probe:Drosophila_2:1629498_at:448:127; Interrogation_Position=3065; Antisense; ACCAGCTGCTCCAGGTGATCGGTAG
>probe:Drosophila_2:1629498_at:408:401; Interrogation_Position=3136; Antisense; GACATGCGAACCTATTGGCTGACCA
>probe:Drosophila_2:1629498_at:305:429; Interrogation_Position=3175; Antisense; GAGTTAACGCCGGATCTGATTAGCA
>probe:Drosophila_2:1629498_at:330:589; Interrogation_Position=3203; Antisense; TGGATACTTTGGACACCTACTGCTC
>probe:Drosophila_2:1629498_at:55:103; Interrogation_Position=3239; Antisense; AGAGCATGGAGGTCTCAGTCCACCA
>probe:Drosophila_2:1629498_at:687:85; Interrogation_Position=3255; Antisense; AGTCCACCAATATTGTAGTCCGGCC
>probe:Drosophila_2:1629498_at:115:505; Interrogation_Position=3272; Antisense; GTCCGGCCTCGAATAACTACAGATT
>probe:Drosophila_2:1629498_at:551:465; Interrogation_Position=3293; Antisense; GATTGGGATCCTGCAACTGTGACAC
>probe:Drosophila_2:1629498_at:627:219; Interrogation_Position=3319; Antisense; AAGTGTTTATATAGCCGTCGTTCGG
>probe:Drosophila_2:1629498_at:369:187; Interrogation_Position=3369; Antisense; AACATCCGAGTTTCCAAAGGTCAGT
>probe:Drosophila_2:1629498_at:693:169; Interrogation_Position=3384; Antisense; AAAGGTCAGTGAACCCGCGCAGGTC
>probe:Drosophila_2:1629498_at:710:293; Interrogation_Position=3472; Antisense; CGATCAGCGCCTAGTATCACATTTA

Paste this into a BLAST search page for me
AGTTCACTCTGGTCCTTGTGCAGCAGAAGATGCCCAGATACTGCCTATTCACCAGCTGCTCCAGGTGATCGGTAGGACATGCGAACCTATTGGCTGACCAGAGTTAACGCCGGATCTGATTAGCATGGATACTTTGGACACCTACTGCTCAGAGCATGGAGGTCTCAGTCCACCAAGTCCACCAATATTGTAGTCCGGCCGTCCGGCCTCGAATAACTACAGATTGATTGGGATCCTGCAACTGTGACACAAGTGTTTATATAGCCGTCGTTCGGAACATCCGAGTTTCCAAAGGTCAGTAAAGGTCAGTGAACCCGCGCAGGTCCGATCAGCGCCTAGTATCACATTTA

Full Affymetrix probeset data:

Annotations for 1629498_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime