FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629499_at:

>probe:Drosophila_2:1629499_at:138:389; Interrogation_Position=2438; Antisense; GAAAAAGCGCTCTCCATAGACGAGG
>probe:Drosophila_2:1629499_at:399:41; Interrogation_Position=2468; Antisense; ATCGAACTAGAAAGACCATCCAGGG
>probe:Drosophila_2:1629499_at:362:609; Interrogation_Position=2521; Antisense; TGAGCCAAAATCGTCCTCCTTTGAA
>probe:Drosophila_2:1629499_at:81:283; Interrogation_Position=2536; Antisense; CTCCTTTGAAGAGGCCACTGAGGCA
>probe:Drosophila_2:1629499_at:535:519; Interrogation_Position=2576; Antisense; GTGGCTGCCCTAAAACAACAACTTT
>probe:Drosophila_2:1629499_at:413:225; Interrogation_Position=2630; Antisense; AAGGACAACCCGCAAGCAGTGGATA
>probe:Drosophila_2:1629499_at:368:209; Interrogation_Position=2643; Antisense; AAGCAGTGGATACCAGCGACAGCAA
>probe:Drosophila_2:1629499_at:81:85; Interrogation_Position=2724; Antisense; AGTCCAAGCCACATCCAAAACCGAG
>probe:Drosophila_2:1629499_at:581:131; Interrogation_Position=2743; Antisense; ACCGAGCACGCTGTACACGAATTTA
>probe:Drosophila_2:1629499_at:397:703; Interrogation_Position=2765; Antisense; TTAGTCCCAGTTAAAGATCCAGTCT
>probe:Drosophila_2:1629499_at:34:99; Interrogation_Position=2779; Antisense; AGATCCAGTCTCCAGAATCCAGCAT
>probe:Drosophila_2:1629499_at:645:45; Interrogation_Position=2802; Antisense; ATCCGCTCCTCTGACTGAGGGTAAA
>probe:Drosophila_2:1629499_at:536:529; Interrogation_Position=2838; Antisense; GGGATCCCAGAGATTCCGATCTGTA
>probe:Drosophila_2:1629499_at:18:373; Interrogation_Position=2927; Antisense; GAAGGATTGTTTACCATAGCTGTTA

Paste this into a BLAST search page for me
GAAAAAGCGCTCTCCATAGACGAGGATCGAACTAGAAAGACCATCCAGGGTGAGCCAAAATCGTCCTCCTTTGAACTCCTTTGAAGAGGCCACTGAGGCAGTGGCTGCCCTAAAACAACAACTTTAAGGACAACCCGCAAGCAGTGGATAAAGCAGTGGATACCAGCGACAGCAAAGTCCAAGCCACATCCAAAACCGAGACCGAGCACGCTGTACACGAATTTATTAGTCCCAGTTAAAGATCCAGTCTAGATCCAGTCTCCAGAATCCAGCATATCCGCTCCTCTGACTGAGGGTAAAGGGATCCCAGAGATTCCGATCTGTAGAAGGATTGTTTACCATAGCTGTTA

Full Affymetrix probeset data:

Annotations for 1629499_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720