FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629500_at:

>probe:Drosophila_2:1629500_at:485:51; Interrogation_Position=102; Antisense; ATGCTGGTATGTGGCAAACCCTGGA
>probe:Drosophila_2:1629500_at:395:173; Interrogation_Position=117; Antisense; AAACCCTGGACCCTGTGATGATTTT
>probe:Drosophila_2:1629500_at:111:433; Interrogation_Position=238; Antisense; GAGTGCTTGAAAACATGCCGTGTGT
>probe:Drosophila_2:1629500_at:669:49; Interrogation_Position=252; Antisense; ATGCCGTGTGTACAGACCTCCAAAT
>probe:Drosophila_2:1629500_at:39:165; Interrogation_Position=273; Antisense; AAATCACGTCTGTTTGCTGCCAATC
>probe:Drosophila_2:1629500_at:43:281; Interrogation_Position=297; Antisense; CTGGGCGACGGCCATTAAGTCAAAC
>probe:Drosophila_2:1629500_at:151:393; Interrogation_Position=337; Antisense; GAAAGCTACCCAGACTATGCAACAT
>probe:Drosophila_2:1629500_at:120:103; Interrogation_Position=374; Antisense; AGACTCCCTGGGTTATTTATCAACA
>probe:Drosophila_2:1629500_at:729:517; Interrogation_Position=406; Antisense; GTGGATAGCGTTGCGATTCTGACAA
>probe:Drosophila_2:1629500_at:5:245; Interrogation_Position=443; Antisense; AATTTGCCATTTTCCATCTGCTTCA
>probe:Drosophila_2:1629500_at:61:285; Interrogation_Position=460; Antisense; CTGCTTCAGCCGTATTTTGGGTGTG
>probe:Drosophila_2:1629500_at:704:563; Interrogation_Position=484; Antisense; GGAATTTGGCATTTTTCCGCAGGCT
>probe:Drosophila_2:1629500_at:718:679; Interrogation_Position=52; Antisense; TATCCAGTAGTAGCAGTTGTCCCTC
>probe:Drosophila_2:1629500_at:292:351; Interrogation_Position=64; Antisense; GCAGTTGTCCCTCAAGGATTTACAA

Paste this into a BLAST search page for me
ATGCTGGTATGTGGCAAACCCTGGAAAACCCTGGACCCTGTGATGATTTTGAGTGCTTGAAAACATGCCGTGTGTATGCCGTGTGTACAGACCTCCAAATAAATCACGTCTGTTTGCTGCCAATCCTGGGCGACGGCCATTAAGTCAAACGAAAGCTACCCAGACTATGCAACATAGACTCCCTGGGTTATTTATCAACAGTGGATAGCGTTGCGATTCTGACAAAATTTGCCATTTTCCATCTGCTTCACTGCTTCAGCCGTATTTTGGGTGTGGGAATTTGGCATTTTTCCGCAGGCTTATCCAGTAGTAGCAGTTGTCCCTCGCAGTTGTCCCTCAAGGATTTACAA

Full Affymetrix probeset data:

Annotations for 1629500_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720