FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629501_at:

>probe:Drosophila_2:1629501_at:105:417; Interrogation_Position=256; Antisense; GAGCTGGGCAGGACCTACGAACCAA
>probe:Drosophila_2:1629501_at:550:469; Interrogation_Position=362; Antisense; GTTCCAGTGCTCAATTAACGACGAT
>probe:Drosophila_2:1629501_at:74:423; Interrogation_Position=397; Antisense; GAGACGAGCAAGCTTCTTTGCACTG
>probe:Drosophila_2:1629501_at:36:627; Interrogation_Position=420; Antisense; TGCCGCCGCAGATATCACTATGAGC
>probe:Drosophila_2:1629501_at:132:617; Interrogation_Position=532; Antisense; TGCAAAGATGATTCCACGCTCTGCC
>probe:Drosophila_2:1629501_at:280:543; Interrogation_Position=561; Antisense; GGATCAACCACAGCAGGAGCACTAT
>probe:Drosophila_2:1629501_at:288:709; Interrogation_Position=650; Antisense; TTACAAGTCTGGACTCGGCCGGAGA
>probe:Drosophila_2:1629501_at:641:15; Interrogation_Position=685; Antisense; ATTATATTCGGCCAGAGCATCGCCT
>probe:Drosophila_2:1629501_at:197:119; Interrogation_Position=713; Antisense; AGCTGCGAACCATTCCGGATTCATA
>probe:Drosophila_2:1629501_at:203:541; Interrogation_Position=729; Antisense; GGATTCATATTCTCGGTCCGTGGCT
>probe:Drosophila_2:1629501_at:87:505; Interrogation_Position=744; Antisense; GTCCGTGGCTAAGCTGCGTATCCAG
>probe:Drosophila_2:1629501_at:649:469; Interrogation_Position=777; Antisense; GTTCGAGGCTGAAACCGGGCAGTTT
>probe:Drosophila_2:1629501_at:143:567; Interrogation_Position=794; Antisense; GGCAGTTTCAGAGCACCGAGGTCAA
>probe:Drosophila_2:1629501_at:641:353; Interrogation_Position=821; Antisense; GCACGCAACTCCAGAATACCTTTTA

Paste this into a BLAST search page for me
GAGCTGGGCAGGACCTACGAACCAAGTTCCAGTGCTCAATTAACGACGATGAGACGAGCAAGCTTCTTTGCACTGTGCCGCCGCAGATATCACTATGAGCTGCAAAGATGATTCCACGCTCTGCCGGATCAACCACAGCAGGAGCACTATTTACAAGTCTGGACTCGGCCGGAGAATTATATTCGGCCAGAGCATCGCCTAGCTGCGAACCATTCCGGATTCATAGGATTCATATTCTCGGTCCGTGGCTGTCCGTGGCTAAGCTGCGTATCCAGGTTCGAGGCTGAAACCGGGCAGTTTGGCAGTTTCAGAGCACCGAGGTCAAGCACGCAACTCCAGAATACCTTTTA

Full Affymetrix probeset data:

Annotations for 1629501_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720