Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629502_at:

>probe:Drosophila_2:1629502_at:422:549; Interrogation_Position=3046; Antisense; GGAGTCGTAGCTCCCGCCAACTCGT
>probe:Drosophila_2:1629502_at:570:519; Interrogation_Position=3094; Antisense; GTGGAGCAGCACGTCGAATGGCAAT
>probe:Drosophila_2:1629502_at:143:251; Interrogation_Position=3103; Antisense; CACGTCGAATGGCAATTGGCGAAAA
>probe:Drosophila_2:1629502_at:23:233; Interrogation_Position=3131; Antisense; AATCGGCCACAAAATAACCGGCTAG
>probe:Drosophila_2:1629502_at:219:181; Interrogation_Position=3181; Antisense; AAACAAATTCGAAGGCTGCCGGAGC
>probe:Drosophila_2:1629502_at:416:371; Interrogation_Position=3191; Antisense; GAAGGCTGCCGGAGCTGTGCTCAAT
>probe:Drosophila_2:1629502_at:631:417; Interrogation_Position=3202; Antisense; GAGCTGTGCTCAATCGCGGATAAGA
>probe:Drosophila_2:1629502_at:611:17; Interrogation_Position=3226; Antisense; ATTTATGAAATGTGTTCCGCCCCGA
>probe:Drosophila_2:1629502_at:354:599; Interrogation_Position=3238; Antisense; TGTTCCGCCCCGATTTGTTCACTTT
>probe:Drosophila_2:1629502_at:297:695; Interrogation_Position=3291; Antisense; TTTCCTTTTTTATGTTGCCGCGCTG
>probe:Drosophila_2:1629502_at:170:627; Interrogation_Position=3306; Antisense; TGCCGCGCTGCACGAAACACAAAAA
>probe:Drosophila_2:1629502_at:349:21; Interrogation_Position=3338; Antisense; ATATTCAGACGTTCGCACAGTGGCC
>probe:Drosophila_2:1629502_at:692:295; Interrogation_Position=3351; Antisense; CGCACAGTGGCCCTAAACATGGTAT
>probe:Drosophila_2:1629502_at:165:513; Interrogation_Position=3357; Antisense; GTGGCCCTAAACATGGTATAAAAGT

Paste this into a BLAST search page for me
GGAGTCGTAGCTCCCGCCAACTCGTGTGGAGCAGCACGTCGAATGGCAATCACGTCGAATGGCAATTGGCGAAAAAATCGGCCACAAAATAACCGGCTAGAAACAAATTCGAAGGCTGCCGGAGCGAAGGCTGCCGGAGCTGTGCTCAATGAGCTGTGCTCAATCGCGGATAAGAATTTATGAAATGTGTTCCGCCCCGATGTTCCGCCCCGATTTGTTCACTTTTTTCCTTTTTTATGTTGCCGCGCTGTGCCGCGCTGCACGAAACACAAAAAATATTCAGACGTTCGCACAGTGGCCCGCACAGTGGCCCTAAACATGGTATGTGGCCCTAAACATGGTATAAAAGT

Full Affymetrix probeset data:

Annotations for 1629502_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime