Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629503_s_at:

>probe:Drosophila_2:1629503_s_at:289:597; Interrogation_Position=326; Antisense; TGTGCACTATCACAGGCCAAAAAGT
>probe:Drosophila_2:1629503_s_at:28:219; Interrogation_Position=347; Antisense; AAGTGTGTACTTGTCCCAAGACCGA
>probe:Drosophila_2:1629503_s_at:575:439; Interrogation_Position=370; Antisense; GAGGCGCGCGATGGCCAACAACAAA
>probe:Drosophila_2:1629503_s_at:24:183; Interrogation_Position=499; Antisense; AAAACTGTGCACCTGCAGTGTCAAT
>probe:Drosophila_2:1629503_s_at:401:67; Interrogation_Position=522; Antisense; ATGGCAGACGGGACCGAATCTTCTC
>probe:Drosophila_2:1629503_s_at:385:365; Interrogation_Position=537; Antisense; GAATCTTCTCAAGCCAACCTACATT
>probe:Drosophila_2:1629503_s_at:396:311; Interrogation_Position=549; Antisense; GCCAACCTACATTAATCTCGCTTGA
>probe:Drosophila_2:1629503_s_at:351:133; Interrogation_Position=573; Antisense; ACCCGCCGCTGTCAAGTTATATGTG
>probe:Drosophila_2:1629503_s_at:466:475; Interrogation_Position=588; Antisense; GTTATATGTGTTCCGAGAACCGAAT
>probe:Drosophila_2:1629503_s_at:487:201; Interrogation_Position=604; Antisense; GAACCGAATACAGAAAACCCGAGAT
>probe:Drosophila_2:1629503_s_at:628:1; Interrogation_Position=620; Antisense; ACCCGAGATTCGCAATAGAGATCCG
>probe:Drosophila_2:1629503_s_at:624:423; Interrogation_Position=637; Antisense; GAGATCCGATAAGCTCCGAACCGAT
>probe:Drosophila_2:1629503_s_at:39:317; Interrogation_Position=649; Antisense; GCTCCGAACCGATGGATCGATCGAT
>probe:Drosophila_2:1629503_s_at:653:9; Interrogation_Position=672; Antisense; ATTCGATCCCTCTCATATGCTGCTG

Paste this into a BLAST search page for me
TGTGCACTATCACAGGCCAAAAAGTAAGTGTGTACTTGTCCCAAGACCGAGAGGCGCGCGATGGCCAACAACAAAAAAACTGTGCACCTGCAGTGTCAATATGGCAGACGGGACCGAATCTTCTCGAATCTTCTCAAGCCAACCTACATTGCCAACCTACATTAATCTCGCTTGAACCCGCCGCTGTCAAGTTATATGTGGTTATATGTGTTCCGAGAACCGAATGAACCGAATACAGAAAACCCGAGATACCCGAGATTCGCAATAGAGATCCGGAGATCCGATAAGCTCCGAACCGATGCTCCGAACCGATGGATCGATCGATATTCGATCCCTCTCATATGCTGCTG

Full Affymetrix probeset data:

Annotations for 1629503_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime