Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629510_at:

>probe:Drosophila_2:1629510_at:531:185; Interrogation_Position=3633; Antisense; AACAACGGAGACAGAGCCTGCGATT
>probe:Drosophila_2:1629510_at:235:391; Interrogation_Position=3670; Antisense; GAAACGGAGACTGACCCTCCAGATG
>probe:Drosophila_2:1629510_at:525:441; Interrogation_Position=3709; Antisense; GTAGAAGTTGCCGTCCCAACTACAG
>probe:Drosophila_2:1629510_at:590:527; Interrogation_Position=3794; Antisense; GGGAAAGCTTTCTAAGTGCCTATCA
>probe:Drosophila_2:1629510_at:364:87; Interrogation_Position=3808; Antisense; AGTGCCTATCAAACACCCATGTGTA
>probe:Drosophila_2:1629510_at:413:561; Interrogation_Position=3833; Antisense; GGAACTACAATAGCCACCTCGATGT
>probe:Drosophila_2:1629510_at:612:161; Interrogation_Position=3865; Antisense; ACAATCTGCCCGTTTGATCTGATGG
>probe:Drosophila_2:1629510_at:676:509; Interrogation_Position=3896; Antisense; GTGAGGATGCGGACTGCTCCTACCT
>probe:Drosophila_2:1629510_at:110:405; Interrogation_Position=3937; Antisense; GACTCCCAAAACGAGCTGCCAAAGA
>probe:Drosophila_2:1629510_at:405:105; Interrogation_Position=3959; Antisense; AGACAAGCCCTCTCTCAATAACTAA
>probe:Drosophila_2:1629510_at:226:173; Interrogation_Position=4047; Antisense; AAAGCGTGCTTGAATTCTGGTAAGT
>probe:Drosophila_2:1629510_at:237:463; Interrogation_Position=4070; Antisense; GTTGAACTCTTCACGCGACTTAATA
>probe:Drosophila_2:1629510_at:683:113; Interrogation_Position=4152; Antisense; AGCAGACGCAGAGAAGCATCCGCCG
>probe:Drosophila_2:1629510_at:206:47; Interrogation_Position=4169; Antisense; ATCCGCCGGCGTAGCGAGTGCTAAA

Paste this into a BLAST search page for me
AACAACGGAGACAGAGCCTGCGATTGAAACGGAGACTGACCCTCCAGATGGTAGAAGTTGCCGTCCCAACTACAGGGGAAAGCTTTCTAAGTGCCTATCAAGTGCCTATCAAACACCCATGTGTAGGAACTACAATAGCCACCTCGATGTACAATCTGCCCGTTTGATCTGATGGGTGAGGATGCGGACTGCTCCTACCTGACTCCCAAAACGAGCTGCCAAAGAAGACAAGCCCTCTCTCAATAACTAAAAAGCGTGCTTGAATTCTGGTAAGTGTTGAACTCTTCACGCGACTTAATAAGCAGACGCAGAGAAGCATCCGCCGATCCGCCGGCGTAGCGAGTGCTAAA

Full Affymetrix probeset data:

Annotations for 1629510_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime