Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629511_at:

>probe:Drosophila_2:1629511_at:77:323; Interrogation_Position=1171; Antisense; GCGACGTTAGTTGGCGCTACCTTAA
>probe:Drosophila_2:1629511_at:533:581; Interrogation_Position=1182; Antisense; TGGCGCTACCTTAAGCTATGCACAC
>probe:Drosophila_2:1629511_at:297:355; Interrogation_Position=1201; Antisense; GCACACTTATTTTTATGGTCCTTCC
>probe:Drosophila_2:1629511_at:669:681; Interrogation_Position=1214; Antisense; TATGGTCCTTCCTTATCCCTGATAT
>probe:Drosophila_2:1629511_at:519:87; Interrogation_Position=1354; Antisense; AGTCGCGTAAGCTTGTTTCGTAGTA
>probe:Drosophila_2:1629511_at:477:471; Interrogation_Position=1383; Antisense; GTTAGTTCGAGGAAAGCGGCCCCAT
>probe:Drosophila_2:1629511_at:443:309; Interrogation_Position=1398; Antisense; GCGGCCCCATTTGTACTTGTTTGGA
>probe:Drosophila_2:1629511_at:632:601; Interrogation_Position=1415; Antisense; TGTTTGGATCAGTCGCCATTGCAGA
>probe:Drosophila_2:1629511_at:262:101; Interrogation_Position=1445; Antisense; AGAGATTGTTGCACCTACTGTATTG
>probe:Drosophila_2:1629511_at:624:513; Interrogation_Position=1503; Antisense; GTGATTAGACTTTATCCTATGGACT
>probe:Drosophila_2:1629511_at:115:583; Interrogation_Position=1560; Antisense; TGGCGAGCCAAAATCGGTGAACTCT
>probe:Drosophila_2:1629511_at:301:613; Interrogation_Position=1577; Antisense; TGAACTCTGAACTTTTGCCTGTCGA
>probe:Drosophila_2:1629511_at:622:303; Interrogation_Position=1612; Antisense; CCGAACTGTCCGCATTATTGTCATG
>probe:Drosophila_2:1629511_at:104:691; Interrogation_Position=1627; Antisense; TATTGTCATGCCCAACTCGATGATG

Paste this into a BLAST search page for me
GCGACGTTAGTTGGCGCTACCTTAATGGCGCTACCTTAAGCTATGCACACGCACACTTATTTTTATGGTCCTTCCTATGGTCCTTCCTTATCCCTGATATAGTCGCGTAAGCTTGTTTCGTAGTAGTTAGTTCGAGGAAAGCGGCCCCATGCGGCCCCATTTGTACTTGTTTGGATGTTTGGATCAGTCGCCATTGCAGAAGAGATTGTTGCACCTACTGTATTGGTGATTAGACTTTATCCTATGGACTTGGCGAGCCAAAATCGGTGAACTCTTGAACTCTGAACTTTTGCCTGTCGACCGAACTGTCCGCATTATTGTCATGTATTGTCATGCCCAACTCGATGATG

Full Affymetrix probeset data:

Annotations for 1629511_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime