FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629515_at:

>probe:Drosophila_2:1629515_at:160:121; Interrogation_Position=1600; Antisense; AGCTGTTGTAGAGCACCATGGCCAT
>probe:Drosophila_2:1629515_at:472:161; Interrogation_Position=1692; Antisense; AAATTTCTGACCAGGGAGGCGGCAT
>probe:Drosophila_2:1629515_at:77:263; Interrogation_Position=1727; Antisense; CAGACCGATCAGCTCTTCAAGTATA
>probe:Drosophila_2:1629515_at:225:91; Interrogation_Position=1746; Antisense; AGTATATGTACAGCACAGCGCCGCA
>probe:Drosophila_2:1629515_at:299:219; Interrogation_Position=1778; Antisense; AAGTCGGATCTGCATACGGTGCCAT
>probe:Drosophila_2:1629515_at:174:705; Interrogation_Position=1802; Antisense; TTAGCGGGCTATGGATACGGTCTGC
>probe:Drosophila_2:1629515_at:269:141; Interrogation_Position=1818; Antisense; ACGGTCTGCCGATCTCAAGGCTTTA
>probe:Drosophila_2:1629515_at:240:689; Interrogation_Position=1850; Antisense; TATTTCCATGGCGACATTGTGCTGC
>probe:Drosophila_2:1629515_at:158:285; Interrogation_Position=1871; Antisense; CTGCTCTCCTGCGAAGGATTCGGAA
>probe:Drosophila_2:1629515_at:26:683; Interrogation_Position=1910; Antisense; TATCTAAAGGCTCTGTCCGACGAAG
>probe:Drosophila_2:1629515_at:455:363; Interrogation_Position=1940; Antisense; GAATTGCTGCCGATCTTCAACAAGA
>probe:Drosophila_2:1629515_at:344:159; Interrogation_Position=1964; Antisense; ACAAGCTCAAAGTTCTATCGCGCCA
>probe:Drosophila_2:1629515_at:421:259; Interrogation_Position=1996; Antisense; CACGGGTGACTGGTCCAATCAGGTA
>probe:Drosophila_2:1629515_at:24:377; Interrogation_Position=2038; Antisense; GAAGACGAGCGCTGTCAACCAGTAG

Paste this into a BLAST search page for me
AGCTGTTGTAGAGCACCATGGCCATAAATTTCTGACCAGGGAGGCGGCATCAGACCGATCAGCTCTTCAAGTATAAGTATATGTACAGCACAGCGCCGCAAAGTCGGATCTGCATACGGTGCCATTTAGCGGGCTATGGATACGGTCTGCACGGTCTGCCGATCTCAAGGCTTTATATTTCCATGGCGACATTGTGCTGCCTGCTCTCCTGCGAAGGATTCGGAATATCTAAAGGCTCTGTCCGACGAAGGAATTGCTGCCGATCTTCAACAAGAACAAGCTCAAAGTTCTATCGCGCCACACGGGTGACTGGTCCAATCAGGTAGAAGACGAGCGCTGTCAACCAGTAG

Full Affymetrix probeset data:

Annotations for 1629515_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720