Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629518_at:

>probe:Drosophila_2:1629518_at:362:275; Interrogation_Position=1282; Antisense; CTATGGCGGCAGAAACCTGGAGGCT
>probe:Drosophila_2:1629518_at:690:587; Interrogation_Position=1299; Antisense; TGGAGGCTGCGACCAACATCATCTT
>probe:Drosophila_2:1629518_at:367:151; Interrogation_Position=1314; Antisense; ACATCATCTTCAGCAACGGTCTTCT
>probe:Drosophila_2:1629518_at:324:197; Interrogation_Position=1328; Antisense; AACGGTCTTCTGGATCCCTGGAGCG
>probe:Drosophila_2:1629518_at:490:521; Interrogation_Position=1353; Antisense; GTGGCGGTGTGCTTCAGGCTCCCAA
>probe:Drosophila_2:1629518_at:693:197; Interrogation_Position=1376; Antisense; AACGACAAGGTCTTCGTCATCATCC
>probe:Drosophila_2:1629518_at:128:435; Interrogation_Position=1406; Antisense; GAGGGAGCCCATCACTTGGACTTGC
>probe:Drosophila_2:1629518_at:547:729; Interrogation_Position=1421; Antisense; TTGGACTTGCGCCACAGCGATCCGG
>probe:Drosophila_2:1629518_at:573:225; Interrogation_Position=1478; Antisense; AAGGAAGCAGCCATCATAGCACGAT
>probe:Drosophila_2:1629518_at:229:441; Interrogation_Position=1500; Antisense; GATGGATCCAAGATTTCTGAAGCGA
>probe:Drosophila_2:1629518_at:321:325; Interrogation_Position=1521; Antisense; GCGAGATTACTTTTACCCATACTGA
>probe:Drosophila_2:1629518_at:401:319; Interrogation_Position=1580; Antisense; GCCGAGCAAGGCCAGATTAATCAAA
>probe:Drosophila_2:1629518_at:347:375; Interrogation_Position=1694; Antisense; GAAGATCCTGTTTGCACATTCGATT
>probe:Drosophila_2:1629518_at:71:547; Interrogation_Position=1778; Antisense; GGATGACGTTTTGGACCTGGCAATG

Paste this into a BLAST search page for me
CTATGGCGGCAGAAACCTGGAGGCTTGGAGGCTGCGACCAACATCATCTTACATCATCTTCAGCAACGGTCTTCTAACGGTCTTCTGGATCCCTGGAGCGGTGGCGGTGTGCTTCAGGCTCCCAAAACGACAAGGTCTTCGTCATCATCCGAGGGAGCCCATCACTTGGACTTGCTTGGACTTGCGCCACAGCGATCCGGAAGGAAGCAGCCATCATAGCACGATGATGGATCCAAGATTTCTGAAGCGAGCGAGATTACTTTTACCCATACTGAGCCGAGCAAGGCCAGATTAATCAAAGAAGATCCTGTTTGCACATTCGATTGGATGACGTTTTGGACCTGGCAATG

Full Affymetrix probeset data:

Annotations for 1629518_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime