FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629519_at:

>probe:Drosophila_2:1629519_at:247:579; Interrogation_Position=114; Antisense; GGCCACGAATGGTGTGCGTTGCTAT
>probe:Drosophila_2:1629519_at:21:437; Interrogation_Position=154; Antisense; GAGGAGCCAATTGCACAGCTTCAGC
>probe:Drosophila_2:1629519_at:633:353; Interrogation_Position=207; Antisense; GCAGCGCCTGTGGAAGCATTATTAT
>probe:Drosophila_2:1629519_at:248:377; Interrogation_Position=219; Antisense; GAAGCATTATTATGCCTCCTCGCAT
>probe:Drosophila_2:1629519_at:436:21; Interrogation_Position=252; Antisense; ATATTGCTTCGATCTGGGTGCGGAT
>probe:Drosophila_2:1629519_at:352:233; Interrogation_Position=285; Antisense; AATGCAGGGCACATTCTCACTGCTA
>probe:Drosophila_2:1629519_at:137:143; Interrogation_Position=303; Antisense; ACTGCTAACCGATTGCCTTGTGGGC
>probe:Drosophila_2:1629519_at:289:275; Interrogation_Position=319; Antisense; CTTGTGGGCACACAGCTAGCTGGTA
>probe:Drosophila_2:1629519_at:309:45; Interrogation_Position=371; Antisense; ATCGCGTTGGTGTCCAGCTGTACGA
>probe:Drosophila_2:1629519_at:694:399; Interrogation_Position=394; Antisense; GACGTGGAATATGCCTTCGGTTTGG
>probe:Drosophila_2:1629519_at:500:437; Interrogation_Position=418; Antisense; GAGGAGCTGGCCAAATCGTGCGACT
>probe:Drosophila_2:1629519_at:271:145; Interrogation_Position=447; Antisense; ACTGCTCATCTGTCACATGGACGAG
>probe:Drosophila_2:1629519_at:727:177; Interrogation_Position=59; Antisense; AAACGGAGCTGGGACACCGCTTGAG
>probe:Drosophila_2:1629519_at:445:167; Interrogation_Position=597; Antisense; AAATGGTATCTTCCCGTTTGTGTCA

Paste this into a BLAST search page for me
GGCCACGAATGGTGTGCGTTGCTATGAGGAGCCAATTGCACAGCTTCAGCGCAGCGCCTGTGGAAGCATTATTATGAAGCATTATTATGCCTCCTCGCATATATTGCTTCGATCTGGGTGCGGATAATGCAGGGCACATTCTCACTGCTAACTGCTAACCGATTGCCTTGTGGGCCTTGTGGGCACACAGCTAGCTGGTAATCGCGTTGGTGTCCAGCTGTACGAGACGTGGAATATGCCTTCGGTTTGGGAGGAGCTGGCCAAATCGTGCGACTACTGCTCATCTGTCACATGGACGAGAAACGGAGCTGGGACACCGCTTGAGAAATGGTATCTTCCCGTTTGTGTCA

Full Affymetrix probeset data:

Annotations for 1629519_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720