FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629520_at:

>probe:Drosophila_2:1629520_at:642:571; Interrogation_Position=274; Antisense; GGCTCAGGGAACCATTGATCACTTC
>probe:Drosophila_2:1629520_at:85:303; Interrogation_Position=298; Antisense; CCGCCTGAACGGTCTGAATGATTTT
>probe:Drosophila_2:1629520_at:448:665; Interrogation_Position=368; Antisense; TACAAGTTCACTTTCCGCGACGTGA
>probe:Drosophila_2:1629520_at:469:323; Interrogation_Position=384; Antisense; GCGACGTGAACGTGGATACCCAATA
>probe:Drosophila_2:1629520_at:702:673; Interrogation_Position=442; Antisense; TACCATCAATCTGATCGGTGCCGGA
>probe:Drosophila_2:1629520_at:28:559; Interrogation_Position=464; Antisense; GGACATGCCAAATTCGCCATCAAGG
>probe:Drosophila_2:1629520_at:393:147; Interrogation_Position=506; Antisense; ACTATGAAGTACTCACTCGGCGTGA
>probe:Drosophila_2:1629520_at:679:331; Interrogation_Position=534; Antisense; GCGGCAACCTGAAGCTGAAGTCATT
>probe:Drosophila_2:1629520_at:227:615; Interrogation_Position=549; Antisense; TGAAGTCATTGGAGGTCCGCACCCA
>probe:Drosophila_2:1629520_at:314:299; Interrogation_Position=570; Antisense; CCCACTTGGGTGAGGTTGATTCCGA
>probe:Drosophila_2:1629520_at:68:727; Interrogation_Position=585; Antisense; TTGATTCCGAGATCGAGGGCATCCT
>probe:Drosophila_2:1629520_at:352:53; Interrogation_Position=635; Antisense; ATGAATGAGTACTTGGCCGAGGCCG
>probe:Drosophila_2:1629520_at:679:373; Interrogation_Position=683; Antisense; GAAGATCTGATTGCCGATACCATCG
>probe:Drosophila_2:1629520_at:274:27; Interrogation_Position=699; Antisense; ATACCATCGAGAGTATTGCCCTGCC

Paste this into a BLAST search page for me
GGCTCAGGGAACCATTGATCACTTCCCGCCTGAACGGTCTGAATGATTTTTACAAGTTCACTTTCCGCGACGTGAGCGACGTGAACGTGGATACCCAATATACCATCAATCTGATCGGTGCCGGAGGACATGCCAAATTCGCCATCAAGGACTATGAAGTACTCACTCGGCGTGAGCGGCAACCTGAAGCTGAAGTCATTTGAAGTCATTGGAGGTCCGCACCCACCCACTTGGGTGAGGTTGATTCCGATTGATTCCGAGATCGAGGGCATCCTATGAATGAGTACTTGGCCGAGGCCGGAAGATCTGATTGCCGATACCATCGATACCATCGAGAGTATTGCCCTGCC

Full Affymetrix probeset data:

Annotations for 1629520_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720