FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629522_at:

>probe:Drosophila_2:1629522_at:426:507; Interrogation_Position=1009; Antisense; GTGCCCGCCGATATATTGGCCAAGG
>probe:Drosophila_2:1629522_at:203:445; Interrogation_Position=571; Antisense; GATGAGGAGACCTTCGCCCTTCTGA
>probe:Drosophila_2:1629522_at:626:275; Interrogation_Position=589; Antisense; CTTCTGATGGCCAACAAGCTGTGGA
>probe:Drosophila_2:1629522_at:505:595; Interrogation_Position=608; Antisense; TGTGGAAATTCATTCGTTCGCGCTC
>probe:Drosophila_2:1629522_at:657:337; Interrogation_Position=629; Antisense; GCTCCCTGCGATACAAGTTCTCAGA
>probe:Drosophila_2:1629522_at:264:33; Interrogation_Position=670; Antisense; ATCAACAGCGATCCGGAGGGCAGTC
>probe:Drosophila_2:1629522_at:599:81; Interrogation_Position=686; Antisense; AGGGCAGTCTGAATTTGGGCGTATC
>probe:Drosophila_2:1629522_at:396:593; Interrogation_Position=803; Antisense; TGGGAGCGCTTCTGCTCAAAGGACT
>probe:Drosophila_2:1629522_at:702:303; Interrogation_Position=839; Antisense; CCGGCAAGGCTCTAATTGTCTCGAA
>probe:Drosophila_2:1629522_at:158:5; Interrogation_Position=853; Antisense; ATTGTCTCGAAAATCGCCTTGCTGC
>probe:Drosophila_2:1629522_at:286:621; Interrogation_Position=875; Antisense; TGCTGGCGGTGATCATCTCACTGAA
>probe:Drosophila_2:1629522_at:625:181; Interrogation_Position=919; Antisense; AAAACCATCGTGGAGGTGCCATCCC
>probe:Drosophila_2:1629522_at:501:397; Interrogation_Position=949; Antisense; GACAGCTATAGCTCCGGGTGGTCGA
>probe:Drosophila_2:1629522_at:69:83; Interrogation_Position=995; Antisense; AGGGACTTGTAGACGTGCCCGCCGA

Paste this into a BLAST search page for me
GTGCCCGCCGATATATTGGCCAAGGGATGAGGAGACCTTCGCCCTTCTGACTTCTGATGGCCAACAAGCTGTGGATGTGGAAATTCATTCGTTCGCGCTCGCTCCCTGCGATACAAGTTCTCAGAATCAACAGCGATCCGGAGGGCAGTCAGGGCAGTCTGAATTTGGGCGTATCTGGGAGCGCTTCTGCTCAAAGGACTCCGGCAAGGCTCTAATTGTCTCGAAATTGTCTCGAAAATCGCCTTGCTGCTGCTGGCGGTGATCATCTCACTGAAAAAACCATCGTGGAGGTGCCATCCCGACAGCTATAGCTCCGGGTGGTCGAAGGGACTTGTAGACGTGCCCGCCGA

Full Affymetrix probeset data:

Annotations for 1629522_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720