Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629523_at:

>probe:Drosophila_2:1629523_at:696:379; Interrogation_Position=2107; Antisense; GAACCTCAACCATCAGAACTTGCTG
>probe:Drosophila_2:1629523_at:120:195; Interrogation_Position=2165; Antisense; AACTGTGGTCCTGCTGCTGAGATAT
>probe:Drosophila_2:1629523_at:488:71; Interrogation_Position=2241; Antisense; AGGCGGAGGCCATTGTGAACCACTT
>probe:Drosophila_2:1629523_at:491:379; Interrogation_Position=2257; Antisense; GAACCACTTGCAAATGACCGGTCAA
>probe:Drosophila_2:1629523_at:161:119; Interrogation_Position=2292; Antisense; AGCTCCATTGCAACGTCAGCAACTG
>probe:Drosophila_2:1629523_at:84:591; Interrogation_Position=2320; Antisense; TGGTTGTCACATGTCTGCGGCAGCA
>probe:Drosophila_2:1629523_at:211:95; Interrogation_Position=2355; Antisense; AGTTGGCCAATCTGCTGAATAGCGG
>probe:Drosophila_2:1629523_at:80:615; Interrogation_Position=2370; Antisense; TGAATAGCGGCATACGTTCGTCGTC
>probe:Drosophila_2:1629523_at:418:497; Interrogation_Position=2392; Antisense; GTCTACCAGCAAACCGCAACGTAAT
>probe:Drosophila_2:1629523_at:458:197; Interrogation_Position=2409; Antisense; AACGTAATCACATTTCTGCCAGCGG
>probe:Drosophila_2:1629523_at:156:27; Interrogation_Position=2484; Antisense; ATAGCAGCTTATCCTTGGCGGCCAA
>probe:Drosophila_2:1629523_at:325:573; Interrogation_Position=2500; Antisense; GGCGGCCAAAAAGACCAGTGTTCAA
>probe:Drosophila_2:1629523_at:445:359; Interrogation_Position=2541; Antisense; GCAACTTTAGCTGTTCGTGGCGATA
>probe:Drosophila_2:1629523_at:354:377; Interrogation_Position=2590; Antisense; GAAGCACGGCATTCATCAGCTGAAG

Paste this into a BLAST search page for me
GAACCTCAACCATCAGAACTTGCTGAACTGTGGTCCTGCTGCTGAGATATAGGCGGAGGCCATTGTGAACCACTTGAACCACTTGCAAATGACCGGTCAAAGCTCCATTGCAACGTCAGCAACTGTGGTTGTCACATGTCTGCGGCAGCAAGTTGGCCAATCTGCTGAATAGCGGTGAATAGCGGCATACGTTCGTCGTCGTCTACCAGCAAACCGCAACGTAATAACGTAATCACATTTCTGCCAGCGGATAGCAGCTTATCCTTGGCGGCCAAGGCGGCCAAAAAGACCAGTGTTCAAGCAACTTTAGCTGTTCGTGGCGATAGAAGCACGGCATTCATCAGCTGAAG

Full Affymetrix probeset data:

Annotations for 1629523_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime