FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629525_at:

>probe:Drosophila_2:1629525_at:413:679; Interrogation_Position=372; Antisense; TAGTGCGCAAAACGAGCCAGATGTC
>probe:Drosophila_2:1629525_at:439:75; Interrogation_Position=426; Antisense; AGGACGCACTGCTCCATGAACTGGG
>probe:Drosophila_2:1629525_at:9:561; Interrogation_Position=475; Antisense; GGAAACCATCTACGATCTGTTGCGC
>probe:Drosophila_2:1629525_at:497:379; Interrogation_Position=517; Antisense; GAAGCCGTGCACTTTGGAGGACCTC
>probe:Drosophila_2:1629525_at:301:549; Interrogation_Position=532; Antisense; GGAGGACCTCAACGTTGTCTACGAG
>probe:Drosophila_2:1629525_at:246:441; Interrogation_Position=557; Antisense; GATGGAATCTTTGTGATGCCGCCCA
>probe:Drosophila_2:1629525_at:302:337; Interrogation_Position=585; Antisense; GCTCCAATGTCTCAGTTGTTCGCAT
>probe:Drosophila_2:1629525_at:594:459; Interrogation_Position=599; Antisense; GTTGTTCGCATCGAGTTTAACCCCA
>probe:Drosophila_2:1629525_at:620:579; Interrogation_Position=643; Antisense; GGCCACGCTTATTGGACTCTGTATA
>probe:Drosophila_2:1629525_at:681:329; Interrogation_Position=684; Antisense; GCGGACTTCCGCACAACATAAAGCT
>probe:Drosophila_2:1629525_at:317:579; Interrogation_Position=790; Antisense; GGCCATGGAGAACCCCAATCTGAGG
>probe:Drosophila_2:1629525_at:567:435; Interrogation_Position=842; Antisense; GAGGAGTAGCTCTCTTTGCCATATC
>probe:Drosophila_2:1629525_at:436:515; Interrogation_Position=908; Antisense; GTGTACCATTAAGTTGCATCAGGGA
>probe:Drosophila_2:1629525_at:695:269; Interrogation_Position=924; Antisense; CATCAGGGAGTGTGTGCTTAGCATT

Paste this into a BLAST search page for me
TAGTGCGCAAAACGAGCCAGATGTCAGGACGCACTGCTCCATGAACTGGGGGAAACCATCTACGATCTGTTGCGCGAAGCCGTGCACTTTGGAGGACCTCGGAGGACCTCAACGTTGTCTACGAGGATGGAATCTTTGTGATGCCGCCCAGCTCCAATGTCTCAGTTGTTCGCATGTTGTTCGCATCGAGTTTAACCCCAGGCCACGCTTATTGGACTCTGTATAGCGGACTTCCGCACAACATAAAGCTGGCCATGGAGAACCCCAATCTGAGGGAGGAGTAGCTCTCTTTGCCATATCGTGTACCATTAAGTTGCATCAGGGACATCAGGGAGTGTGTGCTTAGCATT

Full Affymetrix probeset data:

Annotations for 1629525_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720