FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629530_at:

>probe:Drosophila_2:1629530_at:541:429; Interrogation_Position=121; Antisense; GAGTATGCCAGGATTGCAGTCCGCC
>probe:Drosophila_2:1629530_at:693:239; Interrogation_Position=13; Antisense; AATAGATTCGTCTTGCACGCAGATT
>probe:Drosophila_2:1629530_at:357:387; Interrogation_Position=153; Antisense; GAAAACGTCGTAGTCGGTGGCCAAT
>probe:Drosophila_2:1629530_at:672:531; Interrogation_Position=168; Antisense; GGTGGCCAATCCTACAGGACGGGTA
>probe:Drosophila_2:1629530_at:353:197; Interrogation_Position=206; Antisense; AACGGTGTATATCAATTCCCCTGGC
>probe:Drosophila_2:1629530_at:527:581; Interrogation_Position=227; Antisense; TGGCGCATATCTAGGAGCTCTCGAT
>probe:Drosophila_2:1629530_at:632:637; Interrogation_Position=247; Antisense; TCGATGGTCCCATTCGGCGAACTGG
>probe:Drosophila_2:1629530_at:24:577; Interrogation_Position=294; Antisense; GGCGCCCAGTATCCGGATGGTTACA
>probe:Drosophila_2:1629530_at:442:441; Interrogation_Position=309; Antisense; GATGGTTACAGTGGTCGTCTGCCAG
>probe:Drosophila_2:1629530_at:551:267; Interrogation_Position=331; Antisense; CAGGTGGCACTTACCTTCACAATAA
>probe:Drosophila_2:1629530_at:613:651; Interrogation_Position=353; Antisense; TAAGGATTGCGTGGGCTGCAGCATC
>probe:Drosophila_2:1629530_at:476:219; Interrogation_Position=45; Antisense; AAGTGCCTGATTCTGTCCTTTGCAA
>probe:Drosophila_2:1629530_at:697:627; Interrogation_Position=60; Antisense; TCCTTTGCAATTTTCGTTGTCCTGG
>probe:Drosophila_2:1629530_at:536:571; Interrogation_Position=92; Antisense; GGCTACGGCCGGAAATGTGATTATC

Paste this into a BLAST search page for me
GAGTATGCCAGGATTGCAGTCCGCCAATAGATTCGTCTTGCACGCAGATTGAAAACGTCGTAGTCGGTGGCCAATGGTGGCCAATCCTACAGGACGGGTAAACGGTGTATATCAATTCCCCTGGCTGGCGCATATCTAGGAGCTCTCGATTCGATGGTCCCATTCGGCGAACTGGGGCGCCCAGTATCCGGATGGTTACAGATGGTTACAGTGGTCGTCTGCCAGCAGGTGGCACTTACCTTCACAATAATAAGGATTGCGTGGGCTGCAGCATCAAGTGCCTGATTCTGTCCTTTGCAATCCTTTGCAATTTTCGTTGTCCTGGGGCTACGGCCGGAAATGTGATTATC

Full Affymetrix probeset data:

Annotations for 1629530_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720